جزيئات فيروسية مصممة للتوصيل المؤقت لمجمعات ريبونوكليوبروتين المحرر الرئيسي في الجسم الحي

النتائج

توصيل PE: pegRNA RNPs عبر eVLPs في خلايا مزروعة

الهندسة المنهجية لبنية PE وeVLP

أخيرًا، لتسهيل إطلاق الشحنة، قمنا بإدخال روابط GGS المحيطة بموقع قطع البروتياز المهندسة لزيادة إمكانية الوصول إلى الموقع لمعالجة البروتياز. أظهرت بنية PE-eVLP الإصدار 2.3 الناتجة

(الشكل 1e) التي تحتوي على تقصير MMLV RT، وتحسين NES وتحسين الروابط متوسط تحسين بمقدار 2.6 مرة و1.6 مرة في كفاءة التحرير الأساسي مقارنةً ببنية PE-eVLP الإصدار 1.3 عند أعلى جرعة تم اختبارها عند موضع HEK3 في خلايا HEK293T وموضع Dnmt1 في خلايا N2A، على التوالي (الشكل 1g).

اعتماد أداء PE-eVLP على نوع التحرير

تقييد تعبئة epegRNA يحد من كفاءة PE-eVLP

PE3 يحسن بشكل أكبر التحرير الأساسي باستخدام PE-eVLPs

إزالة امتداد 5′-G تعزز التحرير باستخدام بعض epegRNAs

الشكل 2 | هندسة pegRNA و ngRNA. أ، تجربة نقل مزدوجة تحدد epegRNAs كعنصر محدد في v2.3 PE-eVLPs. ب، مخطط v3 PE-eVLPs باستخدام استراتيجية MCP-MS2 لتجنيد epegRNAs. تتيح دمج استراتيجية MCP-MS2 ثلاثة أوضاع لتحميل RNA الدليل إلى eVLPs: (i) عبر الارتباط بـ PE، (ii) عبر ارتباط حلقة الساق MS2 بـ MCP و (iii) عبر تفاعل ثلاثي المكونات MCP:MS2-gRNAs:PE. ج، كفاءات التحرير لـ v2.3 PE-eVLPs عند موضع Dnmt1 في خلايا N2A مع إدخال حلقة الساق MS2 في مواقع مختلفة في epegRNAs. يشير الطرف 3′ إلى v2.3 PE-eVLPs مع إدخال حلقة الساق MS2 بعد نمط tevoPreQ1 المنظم لـ epegRNA؛ يشير الطرف 3′ * إلى v2.3 PE-eVLPs مع إدخال حلقة الساق MS2 مباشرة بعد تمديد الـ pegRNA، وبالتالي استخدام حلقة الساق MS2 لمحاكاة نمط هيكلي في نهاية epegRNAs؛ TL تشير إلى v2.3 PE-eVLPs مع إدخال حلقة الساق MS2 داخل الحلقة الرباعية من هيكل pegRNA؛ و ST2 تشير إلى v2.3 PE-eVLPs مع إدخال حلقة الساق MS2 داخل حلقة ST2 من هيكل pegRNA. د، خريطة حرارية لكفاءات التحرير من

توصيف تحميل شحنة PE-eVLP

توظيف PE من خلال ارتباط الببتيد الحلزوني

تستفيد BE-eVLPs من هندسة هيكل PE-eVLPs

التوصيل العابر لـ PE بواسطة eVLPs يقلل من التحرير غير المستهدف

الشكل 3 | تطوير v3b PE-eVLPs، التي تستخدم آلية بديلة لتجنيد PE. أ، مخطط لتجنيد PE المعتمد على الببتيد الملفوف. NES، إشارة التصدير النووي. NLS، إشارة التوطين النووي. ب، مقارنة كفاءة التحرير الأساسي مع v2.3 PE-eVLPs مقابل النظام البديل الذي يستخدم الببتيد الملفوف لتجنيد PE. ج، مخطط لنظام v3b PE-eVLP. NES، إشارة التصدير النووي. NLS، إشارة التوطين النووي. د، خريطة حرارية لكفاءات التحرير من تحسين النسبة المولية لبلازميدات Gag-Pol وGag-COM-Pol وGag-P3-Pol لإنتاج v3bPE-eVLPs. هـ، كفاءات التحرير الأساسي مقارنة بين v1.1PE2-eVLPs وv3 PE3-eVLPs وv3b PE3-eVLPs في Dnmt1 وFANCF وCol12a1 و

ب

الشكل 4 | تحرير الجهاز العصبي المركزي باستخدام PE-eVLPs عبر حقن PO ICV. أ، مخطط سير العمل لحقن ICV في حديثي الولادة والتحليل اللاحق. FACS، فرز الخلايا المعتمد على الفلورسنت. ب، كفاءة التحرير الأساسي في مجموعة كبيرة أو مجموعة إيجابية GFP من قشرة الدماغ التي تم جمعها بعد 3 أسابيع من حقن PO ICV.

تقوم PE-eVLPs بوساطة تحرير رئيسي قوي في الدماغ في الجسم الحي

PE-eVLP يصحح الطفرات المسببة لأمراض الشبكية في الجسم الحي

أخيرًا، لاختبار قدرة PE-eVLPs على التوسط في تحرير الجينات العلاجي في الجسم الحي، قمنا بتطبيق PE-eVLPs لعلاج نموذج الفأر rd12. ، الذي يظهر تدهورًا أكثر حدة في الشبكية مما يسمح بتقييم إنقاذ نمط المرض. يحتوي نموذج rd12 على طفرة غير مفيدة في الإكسون 3 من جين صبغة الشبكية 65 (Rpe65) (c. 130 C > T; p.R44X) (الشكل 5h)، مما يؤدي إلى تقليل استجابات تخطيط كهربائية الشبكية (ERG) بدءًا من 3 أسابيع من العمر. . الـ

الطفرة المقابلة في البشر في الشكل المتماثل تسبب عمى ليبر الخلقي . لقد أظهرنا سابقًا إنقاذًا جزئيًا لهذه الظاهرة المرضية باستخدام BE-eVLPs . ومع ذلك، فإن تحرير القاعدة في هذا الموقع ينتج تعديلات غير مستهدفة في الجوار أزواج القواعد التي قد تعطل إنزيم RPE65 وتسبب آثارًا سلبية بينما آلية تحرير الجينات الرئيسية تتجنب بطبيعتها التحرير الجانبي .

نقاش

المحتوى عبر الإنترنت

References

1. Anzalone, A. V. et al. Search-and-replace genome editing without double-strand breaks or donor DNA. Nature 576, 149-157 (2019).
2. Chen, P. J. et al. Enhanced prime editing systems by manipulating cellular determinants of editing outcomes. Cell 184, 5635-5652 e5629 (2021).
3. Newby, G. A. & Liu, D. R. In vivo somatic cell base editing and prime editing. Mol. Ther. 29, 3107-3124 (2021).
4. Nelson, J. W. et al. Engineered pegRNAs improve prime editing efficiency. Nat. Biotechnol. 40, 402-410 (2022).
5. Anzalone, A. V. et al. Programmable deletion, replacement, integration and inversion of large DNA sequences with twin prime editing. Nat. Biotechnol. 40, 731-740 (2022).
6. Choi, J. et al. Precise genomic deletions using paired prime editing. Nat. Biotechnol. 40, 218-226 (2022).
7. Doman, J. L., Sousa, A. A., Randolph, P. B., Chen, P. J. & Liu, D. R. Designing and executing prime editing experiments in mammalian cells. Nat. Protoc. 17, 2431-2468 (2022).
8. Bock, D. et al. In vivo prime editing of a metabolic liver disease in mice. Sci. Transl. Med. 14, eabl9238 (2022).
9. Zheng, C. et al. A flexible split prime editor using truncated reverse transcriptase improves dual-AAV delivery in mouse liver. Mol. Ther. 30, 1343-1351 (2022).
10. Zhi, S. et al. Dual-AAV delivering split prime editor system for in vivo genome editing. Mol. Ther. 30, 283-294 (2022).
11. Qin, H. et al. Vision rescue via unconstrained in vivo prime editing in degenerating neural retinas. J. Exp. Med. https://doi.org/ 10.1084/jem. 20220776 (2023).
12. Gao, R. et al. Genomic and transcriptomic analyses of prime editing guide RNA-independent off-target effects by prime editors. CRISPR J. 5, 276-293 (2022).
13. Kim, D. Y., Moon, S. B., Ko, J. H., Kim, Y. S. & Kim, D. Unbiased investigation of specificities of prime editing systems in human cells. Nucleic Acids Res. 48, 10576-10589 (2020).
14. Liu, Y. et al. Efficient generation of mouse models with the prime editing system. Cell Discov. 6, 27 (2020).
15. Schene, I. F. et al. Prime editing for functional repair in patient-derived disease models. Nat. Commun. 11, 5352 (2020).
16. Geurts, M. H. et al. Evaluating CRISPR-based prime editing for cancer modeling and CFTR repair in organoids. Life Sci. Alliance https://doi.org/10.26508/lsa. 202000940 (2021).
17. Park, S. J. et al. Targeted mutagenesis in mouse cells and embryos using an enhanced prime editor. Genome Biol. 22, 170 (2021).
18. Gao, P. et al. Prime editing in mice reveals the essentiality of a single base in driving tissue-specific gene expression. Genome Biol. 22, 83 (2021).
19. Lin, J. et al. Modeling a cataract disorder in mice with prime editing. Mol. Ther. Nucleic Acids 25, 494-501 (2021).
20. Jin, S. et al. Genome-wide specificity of prime editors in plants. Nat. Biotechnol. 39, 1292-1299 (2021).
21. Habib, O., Habib, G., Hwang, G. H. & Bae, S. Comprehensive analysis of prime editing outcomes in human embryonic stem cells. Nucleic Acids Res. 50, 1187-1197 (2022).
22. She, K. et al. Dual-AAV split prime editor corrects the mutation and phenotype in mice with inherited retinal degeneration. Signal Transduct. Target Ther. 8, 57 (2023).
23. Jang, H. et al. Application of prime editing to the correction of mutations and phenotypes in adult mice with liver and eye diseases. Nat. Biomed. Eng. 6, 181-194 (2022).
24. Liu, B. et al. A split prime editor with untethered reverse transcriptase and circular RNA template. Nat. Biotechnol. 40, 1388-1393 (2022).
25. Davis, J. R. et al. Efficient prime editing in mouse brain, liver and heart with dual AAVs. Nat. Biotechnol. https://doi.org/10.1038/ s41587-023-01758-z (2023).
26. Wu, Z., Yang, H. & Colosi, P. Effect of genome size on AAV vector packaging. Mol. Ther. 18, 80-86 (2010).
27. Davis, J. R. et al. Efficient in vivo base editing via single adeno-associated viruses with size-optimized genomes encoding compact adenine base editors. Nat. Biomed. Eng. 6, 1272-1283 (2022).
28. Taha, E. A., Lee, J. & Hotta, A. Delivery of CRISPR-Cas tools for in vivo genome editing therapy: trends and challenges. J. Control. Release 342, 345-361 (2022).
29. Chandler, R. J., Sands, M. S. & Venditti, C. P. Recombinant adeno-associated viral integration and genotoxicity: insights from animal models. Hum. Gene Ther. 28, 314-322 (2017).
30. Kazemian, P. et al. Lipid-nanoparticle-based delivery of CRISPR/ Cas9 genome-editing components. Mol. Pharm. 19, 1669-1686 (2022).
31. Loughrey, D. & Dahlman, J. E. Non-liver mRNA delivery. Acc. Chem. Res. 55, 13-23 (2022).
32. Breda, L. et al. In vivo hematopoietic stem cell modification by mRNA delivery. Science 381, 436-443 (2023).
33. Raguram, A., Banskota, S. & Liu, D. R. Therapeutic in vivo delivery of gene editing agents. Cell 185, 2806-2827 (2022).
34. Lyu, P., Wang, L. & Lu, B. Virus-like particle mediated CRISPR/Cas9 delivery for efficient and safe genome editing. Life https://doi.org/ 10.3390/life10120366 (2020).
35. Garnier, L., Wills, J. W., Verderame, M. F. & Sudol, M. WW domains and retrovirus budding. Nature 381, 744-745 (1996).
36. Choi, J. G. et al. Lentivirus pre-packed with Cas9 protein for safer gene editing. Gene Ther. 23, 627-633 (2016).
37. Campbell, L. A. et al. Gesicle-mediated delivery of CRISPR/Cas9 ribonucleoprotein complex for inactivating the HIV provirus. Mol. Ther. 27, 151-163 (2019).
38. Lyu, P., Javidi-Parsijani, P., Atala, A. & Lu, B. Delivering Cas9/ sgRNA ribonucleoprotein (RNP) by lentiviral capsid-based bionanoparticles for efficient ‘hit-and-run’ genome editing. Nucleic Acids Res. 47, e99 (2019).
39. Mangeot, P. E. et al. Genome editing in primary cells and in vivo using viral-derived Nanoblades loaded with Cas9-sgRNA ribonucleoproteins. Nat. Commun. 10, 45 (2019).
40. Gee, P. et al. Extracellular nanovesicles for packaging of CRISPRCas9 protein and sgRNA to induce therapeutic exon skipping. Nat. Commun. 11, 1334 (2020).
41. Indikova, I. & Indik, S. Highly efficient ‘hit-and-run’ genome editing with unconcentrated lentivectors carrying Vpr.Prot.Cas9 protein produced from RRE-containing transcripts. Nucleic Acids Res. 48, 8178-8187 (2020).
42. Hamilton, J. R. et al. Targeted delivery of CRISPR-Cas9 and transgenes enables complex immune cell engineering. Cell Rep. 35, 109207 (2021).
43. Yao, X. et al. Engineered extracellular vesicles as versatile ribonucleoprotein delivery vehicles for efficient and safe CRISPR genome editing. J. Extracell. Vesicles 10, e12076 (2021).
44. Banskota, S. et al. Engineered virus-like particles for efficient in vivo delivery of therapeutic proteins. Cell 185, 250-265 e216 (2022).
45. Zuris, J. A. et al. Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo. Nat. Biotechnol. 33, 73-80 (2015).
46. Rees, H. A. et al. Improving the DNA specificity and applicability of base editing through protein engineering and protein delivery. Nat. Commun. 8, 15790 (2017).
47. Tozser, J. Comparative studies on retroviral proteases: substrate specificity. Viruses 2, 147-165 (2010).
48. Lim, K. I., Klimczak, R., Yu, J. H. & Schaffer, D. V. Specific insertions of zinc finger domains into Gag-Pol yield engineered retroviral vectors with selective integration properties. Proc. Natl Acad. Sci. USA 107, 12475-12480 (2010).
49. Dhindsa, R. S. et al. A minimal role for synonymous variation in human disease. Am. J. Hum. Genet. 109, 2105-2109 (2022).
50. Kruglyak, L. et al. Insufficient evidence for non-neutrality of synonymous mutations. Nature 616, E8-E9 (2023).
51. Chen, B. et al. Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/Cas system. Cell 155, 1479-1491 (2013).
52. Bernardi, A. & Spahr, P. F. Nucleotide sequence at the binding site for coat protein on RNA of bacteriophage R17. Proc. Natl Acad. Sci. USA 69, 3033-3037 (1972).
53. Lu, Z. et al. Lentiviral capsid-mediated Streptococcus pyogenes Cas9 ribonucleoprotein delivery for efficient and safe multiplex genome editing. CRISPR J. 4, 914-928 (2021).
54. Lyu, P. et al. Adenine base editor ribonucleoproteins delivered by lentivirus-like particles show high on-target base editing and undetectable RNA off-target activities. CRISPR J. 4, 69-81 (2021).
55. Feng, Y. et al. Enhancing prime editing efficiency and flexibility with tethered and split pegRNAs. Protein Cell 14, 304-308 (2023).
56. Chen, R. et al. Enhancement of a prime editing system via optimal recruitment of the pioneer transcription factor P65. Nat. Commun. 14, 257 (2023).
57. Ma, H. et al. Pol III promoters to express small RNAs: delineation of transcription initiation. Mol. Ther. Nucleic Acids 3, e161 (2014).
58. Kulcsar, P. I. et al. Blackjack mutations improve the on-target activities of increased fidelity variants of SpCas9 with 5’G-extended sgRNAs. Nat. Commun. 11, 1223 (2020).
59. Mullally, G. et al. 5′ modifications to CRISPR-Cas9 gRNA can change the dynamics and size of R-loops and inhibit DNA cleavage. Nucleic Acids Res. 48, 6811-6823 (2020).
60. Mason, J. M. & Arndt, K. M. Coiled coil domains: stability, specificity, and biological implications. ChemBioChem 5, 170-176 (2004).
61. Lebar, T., Lainscek, D., Merljak, E., Aupic, J. & Jerala, R. A tunable orthogonal coiled-coil interaction toolbox for engineering mammalian cells. Nat. Chem. Biol. 16, 513-519 (2020).
62. Richter, M. F. et al. Phage-assisted evolution of an adenine base editor with improved Cas domain compatibility and activity. Nat. Biotechnol. 38, 883-891 (2020).
63. Gaudelli, N. M. et al. Programmable base editing of to in genomic DNA without DNA cleavage. Nature 551, 464-471 (2017).
64. Neugebauer, M. E. et al. Evolution of an adenine base editor into a small, efficient cytosine base editor with low off-target activity. Nat. Biotechnol. https://doi.org/10.1038/s41587-022-01533-6 (2022).
65. Cameron, P. et al. Mapping the genomic landscape of CRISPRCas9 cleavage. Nat. Methods 14, 600-606 (2017).
66. Liang, S. Q. et al. Genome-wide profiling of prime editor off-target sites in vitro and in vivo using PE-tag. Nat. Methods https://doi.org/10.1038/s41592-023-01859-2 (2023).
67. Farhy-Tselnicker, I. & Allen, N. J. Astrocytes, neurons, synapses: a tripartite view on cortical circuit development. Neural Dev. 13, 7 (2018).
68. Semple, B. D., Blomgren, K., Gimlin, K., Ferriero, D. M. & Noble-Haeusslein, L. J. Brain development in rodents and humans: Identifying benchmarks of maturation and vulnerability to injury across species. Prog. Neurobiol. 106-107, 1-16 (2013).
69. Gusel’nikova, V. V. & Korzhevskiy, D. E. NeuN as a neuronal nuclear antigen and neuron differentiation marker. Acta Naturae 7, 42-47 (2015).
70. Kato, S. et al. Selective neural pathway targeting reveals key roles of thalamostriatal projection in the control of visual discrimination. J. Neurosci. 31, 17169-17179 (2011).
71. Kameya, S. et al. Mfrp, a gene encoding a frizzled related protein, is mutated in the mouse retinal degeneration 6. Hum. Mol. Genet. 11, 1879-1886 (2002).
72. Ayala-Ramirez, R. et al. A new autosomal recessive syndrome consisting of posterior microphthalmos, retinitis pigmentosa,
    foveoschisis, and optic disc drusen is caused by a MFRP gene mutation. Mol. Vis. 12, 1483-1489 (2006).
73. Yan, A. L., Du, S. W. & Palczewski, K. Genome editing, a superior therapy for inherited retinal diseases. Vision Res. 206, 108192 (2023).
74. Puppo, A. et al. Retinal transduction profiles by high-capacity viral vectors. Gene Ther. 21, 855-865 (2014).
75. Suh, S. et al. Restoration of visual function in adult mice with an inherited retinal disease via adenine base editing. Nat. Biomed. Eng. 5, 169-178 (2021).
76. Tsai, S. Q. et al. CIRCLE-seq: a highly sensitive in vitro screen for genome-wide CRISPR-Cas9 nuclease off-targets. Nat. Methods 14, 607-614 (2017).
77. Pang, J. J. et al. Retinal degeneration 12 (rd12): a new, spontaneously arising mouse model for human Leber congenital amaurosis (LCA). Mol. Vis. 11, 152-162 (2005).
78. Zhong, Z. et al. Seven novel variants expand the spectrum of RPE65-related Leber congenital amaurosis in the Chinese population. Mol. Vis. 25, 204-214 (2019).
79. Dong, W. & Kantor, B. Lentiviral vectors for delivery of gene-editing systems based on CRISPR/Cas: current state and perspectives. Viruses https://doi.org/10.3390/v13071288 (2021).
80. Schellekens, H. Bioequivalence and the immunogenicity of biopharmaceuticals. Nat. Rev. Drug Discov. 1, 457-462 (2002).

طرق

الاستنساخ الجزيئي

زراعة الخلايا

إنتاج PE-eVLP

نقل PE-eVLP في الخلايا المزروعة وجمع الحمض النووي الجيني

HTS لعينات الحمض النووي الجينومي

تحليل بيانات HTS

نقل البلازميد

تحديد محتوى بروتين PE-eVLP بواسطة ELISA

تحديد محتوى pegRNA في PE-eVLP بواسطة RT-qPCR

DLS

تحليل Western blot لمحتوى بروتين lysate الخلايا المنتجة

تحليل Western blot لمحتوى بروتين PE-eVLP

تحليل الأهداف الجانبية في الخلايا المزروعة

إنتاج الفيروسات القهقرية

الحيوانات

حقن POICV وجمع الأنسجة

العزل النووي والفرز

حقن تحت الشبكية

تخطيط كهربائية الشبكية

فصل RPE وتحضير الحمض النووي الجيني والحمض النووي الريبي

تحليل البقعة الغربية لاستخراج أنسجة RPE من الفئران

التلوين المناعي النسجي لشرائح RPE المسطحة والشرائح المجمدة

ترشيح مواقع غير مستهدفة بواسطة CIRCLE-seq لـ و نماذج

الإحصائيات وإمكانية التكرار

ملخص التقرير

توفر البيانات

توفر الشيفرة

References

81. Renner, T. M., Tang, V. A., Burger, D. & Langlois, M. A. Intact viral particle counts measured by flow virometry provide insight into the infectivity and genome packaging efficiency of Moloney Murine Leukemia virus. J. Virol. https://doi.org/10.1128/JVI.01600-19 (2020).
82. Levy, J. M. et al. Cytosine and adenine base editing of the brain, liver, retina, heart and skeletal muscle of mice via adeno-associated viruses. Nat. Biomed. Eng. 4, 97-110 (2020).
83. Golczak, M., Kiser, P. D., Lodowski, D. T., Maeda, A. & Palczewski, K. Importance of membrane structural integrity for RPE65 retinoid isomerization activity. J. Biol. Chem. 285, 9667-9682 (2010).
84. Lazzarotto, C. R. et al. CHANGE-seq reveals genetic and epigenetic effects on CRISPR-Cas9 genome-wide activity. Nat. Biotechnol. 38, 1317-1327 (2020).
85. circleseq. GitHub https://github.com/tsailabSJ/circleseq (2018)
86. An, M. et al. Engineered virus-like particles for transient delivery of prime editor ribonucleoprotein complexes in vivo. NCBI https://www.ncbi.nlm.nih.gov/bioproject/PRJNA980181 (2023).

شكر وتقدير

مساهمات المؤلفين

المصالح المتنافسة

معلومات إضافية

معلومات إعادة الطباعة والتصاريح متاحة علىwww.nature.com/reprints.

الشكل البياني الممتد 1 | التعديلات التي تتجنب MMR تدعم تحرير البرايم بشكل أكثر كفاءة. تثبيت الطفرات القريبة يحسن كفاءات تحرير البرايم لـ v2.3 PE-eVLPs في موضع HEK3 وموضع Dnmt1 في خلايا HEK293T وN2A على التوالي. القيم المعروضة في جميع الرسوم البيانية تمثل متوسط تحرير البرايم
كفاءة التحرير لثلاث نسخ بيولوجية وتمثل أشرطة الخطأ الانحراف المعياري. تم ملاءمة البيانات لمنحنيات لوجستية بأربعة معلمات باستخدام الانحدار غير الخطي.

الشكل البياني الممتد 3 | تحسين تحميل وتوصيل شحنة eVLP. أ، التغير النسبي في كفاءة تحرير PE-eVLP مقارنةً بالـ 5′ G غير المتطابقة الأصلية + 20-bp epegRNA protospacer. ب، قياس عدد جزيئات eVLP لكل وحدة حجم في تحضيرات الأجيال المتعاقبة من PE-eVLPs بواسطة ELISA مضاد MLV p30. تم استخدام هذه البيانات الكمية في

• 5′ G+20-bp GTGACTTCCATGGTTCCACAA
• 20-زوج قاعدي TGACTTCCATGGTTCCACAA
• 5 ‘ G+19-bp GGACTTCCATGGTTCCACAA
  

  

  
  تجارب لتحديد عدد جزيئات بروتين محرر الأحماض النووية epegRNA و eVLP كما هو موضح في الشكل 2g، h. ج، نسبة تكوين epegRNA و ngRNA في v3 PE2-eVLPs و v3 PE3-eVLPs. تمثل البيانات القيمة المتوسطة لثلاث تكرارات فنية وتمثل أشرطة الخطأ الانحراف المعياري.
  

  

الشكل 4 من البيانات الموسعة | تحسين وتوصيف v3b PE-eVLP.
a، تمثيل غربي يقارن تعبير بروتين الاندماج gag-PE من v3 PE-eVLPs مقابل بروتين الاندماج P4-PE من v3b PE-eVLPs في خلايا المنتج التي تم نقلها بالبروتينات الاندماجية المقابلة. ب، كفاءات التحرير الأولي لـ v3b PE-eVLPs مع Gag-P3-Pol أو Gag-MCP-P3-Pol. بناء الاندماج Gag-MCP-P3-Pol غير متوافق مع الإنتاج الفعال لـ PE-eVLPs. ج، كفاءات التحرير لـ v3b PE-eVLPs عند موضع Dnmt1 في خلايا N2A مع إدخال الأبتامر Com في مواقع مختلفة في epegRNAs. موضع إدخال الأبتامر Com هو كما يلي: يشير إلى v3b PE-eVLPs مع إدخال الأبتامر Com بعد نمط tevoPreQ1 المنظم لـ
epegRNA؛ 3 * تشير إلى v3b PE-eVLPs مع إدخال الأبتامر Com مباشرة بعد الامتداد 3′ من pegRNA، مما يستخدم الأبتامر Com لمحاكاة نمط هيكلي في الطرف 3′ من epegRNAs؛ TL تشير إلى v3b PE-eVLPs مع إدخال الأبتامر Com داخل الحلقة الرباعية من هيكل pegRNA؛ ST2 تشير إلى v3b PE-eVLPs مع إدخال الأبتامر Com داخل حلقة ST2 من هيكل pegRNA. د، تمثيل غربي يقيّم كمية الحمولة PE المعبأة في v1.3 و v2.3 و v3 و v3b PE-eVLPs. الأشكال المعروضة في (أ) و (د) هي صور تمثيلية من تجربتين مكررتين بشكل مستقل. القيم المعروضة في (ب) و (ج) تمثل متوسط كفاءة التحرير الأساسي لثلاث نسخ بيولوجية والأشرطة الخطأ تمثل الانحراف المعياري.

الشكل البياني الممتد 5|توصيف PE-eVLPs. أ، مقارنة كفاءة التحرير الأساسي (% التحرير) وتوليد المنتجات الجانبية للإدخال والحذف (% indel) لنظام PE3 المقدم عن طريق نقل البلازميد مقابل v3 PE3-eVLP. يستهدف نظام PE3 موضع Dnmt1 في خلايا N2A. تمثل البيانات متوسط كفاءة التحرير الأساسي لثلاث تكرارات بيولوجية وتمثل أشرطة الخطأ الانحراف المعياري. ب، كفاءات التحرير الأساسي عند موضع Dnmt1 في خلايا N2A و
b

	بروتينات ملحقة	بروتينات الشحن	ARNs الموجهة	تحسينات من النسخة السابقة
الإصدار 1.1	غير متوفر		pegRNA
الإصدار 1.2	غير متوفر		epegRNA	epegRNA
الإصدار 1.3	غير متوفر		epegRNA	PEmax
الإصدار 2.1	غير متوفر		epegRNA	قصّ MMLV RT
الإصدار 2.2	غير متوفر			تحسين NES
الإصدار 2.3	غير متوفر		epegRNA	تحسين الرابط
v3			MS2-epegRNA	تجنيد gRNA عبر تفاعل MCP:MS2
v3b				توظيف الشحن عبر تفاعل P3-P4؛ توظيف gRNA عبر تفاعل COM:Com

الشكل التوضيحي الممتد 6 | ملخص تخطيطي لتصاميم PE-eVLP. مخطط للبروتينات المساعدة، بروتينات الحمولة، تصاميم RNA الموجه، ووصف التحسينات من النسخة السابقة للأجيال المتعاقبة من PE-eVLPs. بروتين الغلاف VSV-G، وبروتين القفيصة MMLV Gag-Pol الذي هو شائع في
تم استبعاد جميع نسخ PE-eVLPs من الجدول. المخططات المعروضة في الجدول تمثل PE2-eVLPs. بالنسبة لـ PE3-eVLPs، يتم تعبئة ngRNAs إضافية بنسبة 4:1 للـ pegRNAs و ngRNAs مع تعديل السقالة المناسب وإدخال الأبتامر.

الشكل 9 من البيانات الموسعة | تلطيخ المناعة النسيجية على مقاطع العين المجمدة من فئران rd6. مقاطع الشبكية المجمدة من الفئران غير المعالجة تم صبغ الفئران rd6 المعالجة بـ v3 PE3b-eVLP بـ DAPI (الأزرق). الصورة المعروضة هي صورة تمثيلية من تجربتين تم تكرارهما بشكل مستقل.

الشكل 10 من البيانات الموسعة | تحليل الأهداف غير المستهدفة في فئران rd12. أ، تحليل التحرير المعتمد على PE في الموقع المستهدف وفي أعلى 10 مواقع غير مستهدفة تم ترشيحها بواسطة CIRCLE-seq المرتبطة بتسلسل epegRNA الخاص بـ rd12. ب، تحليل الإضافات والحذف في الموقع المستهدف وأعلى 10 مواقع غير مستهدفة تم ترشيحها بواسطة CIRCLE-seq.
b

مرتبطة بتسلسل rd12ngRNA. تمثل الأعمدة القيم المتوسطة لـ (غير معالج) أو (معالجة v3PE3b-eVLP)، حيث يمثل كل نقطة فأرًا فرديًا وأشرطة الخطأ تمثل الانحراف المعياري.

محفظة الطبيعة

ملخص التقرير

الإحصائيات

البرمجيات والشيفرة

معلومات السياسة حول توفر كود الكمبيوتر

جمع البيانات

تحليل البيانات

بيانات

معلومات السياسة حول توفر البيانات

• رموز الانضمام، معرفات فريدة، أو روابط ويب لمجموعات البيانات المتاحة للجمهور
• وصف لأي قيود على توفر البيانات
• بالنسبة لمجموعات البيانات السريرية أو بيانات الطرف الثالث، يرجى التأكد من أن البيان يتماشى مع سياستنا

البحث الذي يتضمن مشاركين بشريين، بياناتهم، أو مواد بيولوجية

التقارير المتخصصة في المجال

تصميم دراسة العلوم الحياتية

التقارير عن مواد وأنظمة وطرق محددة

المواد والأنظمة التجريبية			طرق
غير متوفر	مشارك في الدراسة	غير متوفر	مشارك في الدراسة
	علم الحفريات وعلم الآثار
إكس

الأجسام المضادة

خطوط خلايا حقيقية النواة

معلومات السياسة حول خطوط الخلايا والجنس والنوع في البحث

الحيوانات وغيرها من الكائنات البحثية

تدفق الخلايا

المؤامرات

المنهجية

Engineered virus-like particles for transient delivery of prime editor ribonucleoprotein complexes in vivo

Results

Delivery of PE:pegRNA RNPs via eVLPs in cultured cells

Systematic engineering of PE and eVLP architecture

Lastly, to facilitate cargo release, we inserted GGS linkers flanking the engineered protease cleavage site to increase the accessibility of the site for protease processing. The resulting v2.3 PE-eVLP architecture

(Fig. 1e) containing MMLV RT truncation, NES optimization and linker optimization showed an average 2.6 -fold and 1.6 -fold improvement in prime editing efficiency over the v1.3PE-eVLP architecture at the highest dose tested at the HEK3 locus in HEK293T cells and Dnmt1 locus in N2A cells, respectively (Fig. 1g).

Dependence of PE-eVLP performance on edit type

Insufficient epegRNA packaging limits PE-eVLP efficiency

PE3 further improves prime editing with PE-eVLPs

5′-G extension removal enhances editing with certain epegRNAs

Fig. 2 | Engineering of pegRNA and ngRNA. a, A dual transfection/transduction experiment identifies epegRNAs as the limiting component in the v2.3 PE-eVLPs. b, Schematic of v3 PE-eVLPs utilizing the MCP-MS2 strategy for the recruitment of epegRNAs. The incorporation of MCP-MS2 strategy enables three modes of guide RNA loading into eVLPs: (i) via binding to PE, (ii) via MS2 stem-loop binding to MCP and (iii) via MCP:MS2-gRNAs:PE three-component interaction. c, Editing efficiencies of v2.3 PE-eVLPs at the Dnmt1 locus in N2A cells with MS2 stem-loop insertion at various locations in epegRNAs. The 3′ end denotes v2.3 PE-eVLPs with insertion of the MS2 stem-loop after the structured tevoPreQ1 motif of the epegRNA; 3 ‘ end* denotes v2.3 PE-eVLPs with insertion of the MS2 stem-loop directly after the extension of the pegRNA, thereby using the MS2 stem-loop to mimic a structured motif at the end of epegRNAs; TL denotes v2.3 PE-eVLPs with insertion of the MS2 stem-loop within the tetraloop of the pegRNA scaffold; and ST2 denotes v2.3 PE-eVLPs with insertion of the MS2 stem-loop within the ST2 loop of the pegRNA scaffold. d, Heatmap of editing efficiencies from

Characterization of PE-eVLP cargo loading

PE recruitment via coiled-coil peptide association

BE-eVLPs benefit from the engineered PE-eVLPs architecture

Transient delivery of PE by eVLPs reduces off-target editing

Fig. 3 | Development of v3b PE-eVLPs, which use an alternative PE recruitment mechanism. a, Schematic of coiled-coil peptide-dependent recruitment of PE. NES, nuclear export signal. NLS, nuclear localization signal. b, Comparison of prime editing efficiency with v2.3 PE-eVLPs versus the alternative system employing coiled-coil peptide for the recruitment of PE. c, Schematic of v3b PE-eVLP system. NES, nuclear export signal. NLS, nuclear localization signal. d, Heatmap of editing efficiencies from stoichiometry optimization of Gag-Pol, Gag-COM-Pol and Gag-P3-Pol plasmids for production of v3bPE-eVLPs. e, Prime editing efficiencies comparing v1.1PE2-eVLPs, v3 PE3-eVLPs and v3b PE3-eVLPs at Dnmt1, FANCF, Col12a1 and

b

Fig. 4 | CNS editing with PE-eVLPs via PO ICV injection. a, Schematic of workflow for neonatal ICV injection and subsequent analysis. FACS, fluorescenceactivated cell sorting. b, Prime editing efficiency in bulk or GFP-positive population from the brain cortex collected 3 weeks following PO ICV injection

PE-eVLPs mediate potent in vivo prime editing in the brain

PE-eVLP corrects mutations causing retinal diseases in vivo

Finally, to further test the ability of PE-eVLPs to mediate therapeutic in vivo prime editing, we applied PE-eVLPs to treat the rd12 mouse model , which displays more severe retinal degeneration that allows evaluation of disease phenotype rescue. The rd12 model contains a nonsense mutation in exon 3 of the retinal pigment epithelium 65 (Rpe65) gene (c. 130 C > T; p.R44X) (Fig. 5h), leading to diminishment of electroretinogram (ERG) responses from 3 weeks of age . The

corresponding mutation in humans in homozygous form causes Leber congenital amaurosis . We previously demonstrated partial rescue of this disease phenotype using BE-eVLPs . However, base editing at this site generates bystander edits at nearby base pairs that may inactivate the RPE65 enzyme and cause adverse effects , whereas the mechanism of prime editing inherently avoids bystander editing .