إصابة الحبل الشوكي (SCI) تؤدي إلى فقدان دائم في الحركة والإحساس، وهو ما يتفاقم بسبب الالتهاب داخل الحبل الشوكي ويستمر لعدة أشهر إلى سنوات بعد الإصابة. بعد الإصابة، تتسلل البلعميات المشتقة من وحيدات النواة (MDMs) إلى المنطقة المصابة للمساعدة في إزالة الحطام الغني بالميالين. خلال عملية إزالة الحطام، تتبنى MDMs نمطًا ظاهريًا مؤيدًا للالتهاب مما يزيد من التنكس العصبي ويعيق التعافي. السبب الأساسي لتحول نمط MDM المؤيد للالتهاب المرتبط بالدهون غير واضح. تشير أعمالنا السابقة إلى أن الفوسفوليباز A2 السيتوزولي (cPLA2) يلعب دورًا في تأثير تعزيز الالتهاب للميالين على البلعميات في المختبر. يقوم الفوسفوليباز A2 السيتوزولي (cPLA2) بتحرير حمض الأراكيدونيك من الفوسفوليبيدات، مما ينتج عنه الإيكوسانويدات التي تلعب دورًا مهمًا في الالتهاب والمناعة والدفاع عن المضيف. يتم التعبير عن cPLA2 في البلعميات إلى جانب أنواع خلايا متعددة أخرى بعد الإصابة، وقد تم الإبلاغ عن أن تثبيط cPLA2 يقلل من استعادة علم الأمراض الناتجة عن الإصابة الثانوية ويزيدها. دور cPLA2 في MDMs بعد الإصابة غير مفهوم تمامًا. نفترض أن تنشيط cPLA2 في MDMs بعد الإصابة يساهم في الإصابة الثانوية. هنا، نبلغ أن cPLA2 يلعب دورًا مهمًا في نمط البلعميات الالتهابية المستحثة بالميالين في المختبر باستخدام البلعميات المشتقة من نخاع العظام الذي تم حذف cPLA2 منه. علاوة على ذلك، للتحقيق في دور cPLA2 في MDMs بعد الإصابة، قمنا بإنشاء شيميرات من نخاع العظام الأنثوي باستخدام متبرعين محذوفين من cPLA2 وقمنا بتقييم استعادة الحركة باستخدام مقياس باسو للفئران (BMS)، ونظام تحليل المشي كات ووك، ومهمة السلم الأفقي على مدى ستة أسابيع. كما قمنا بتقييم الحفاظ على الأنسجة وكثافة المحاور داخل الإصابة بعد ستة أسابيع من الإصابة. لم تظهر الشيميرات المحذوفة من cPLA2 أي تغيير في استعادة الحركة أو علم الأمراض النسيجية بعد الإصابة مقارنةً بشيميرات التحكم WT. تشير هذه البيانات إلى أنه على الرغم من أن cPLA2 يلعب دورًا حاسمًا في تعزيز تنشيط البلعميات المؤيدة للالتهاب المستحث بالميالين في المختبر، إلا أنه قد لا يساهم في علم الأمراض الناتج عن الإصابة الثانوية في الجسم الحي بعد الإصابة.

الكلمات الرئيسية: إصابة الحبل الشوكي، فوسفوليباز A2 السيتوزولي، البلعميات، المايلين، الالتهاب

إصابة الحبل الشوكي (SCI) هي حالة مدمرة تؤدي إلى عجز وظيفي كبير وتقلل بشكل كبير من جودة حياة الأفراد المصابين. تتبع الصدمة الميكانيكية الأولية على نسيج الحبل الشوكي، المعروفة بالإصابة الأولية، أحداث بيولوجية تفاقم من تلف الأنسجة. تشمل هذه الإصابة الثانوية سلسلة بيولوجية معقدة تتضمن، ولكن لا تقتصر على، الالتهاب، وتنشيط الخلايا العصبية المقيمة، وتسلل الكريات البيضاء المحيطية، والإجهاد التأكسدي. تفاقم الإصابة الثانوية تلف الأنسجة وتعيق التعافي، مما يحد من الإصلاح الذاتي. .

في الحبل الشوكي المصاب، تلعب البلعميات المنشطة، المكونة من الخلايا الدبقية المقيمة والبلعميات المشتقة من وحيدات النوى المتسللة، دورًا كبيرًا في استجابة الإصابة الثانوية وتساهم في كل من الإصابة والإصلاح. سواء اعتمدت البلعميات الكبيرة نمطًا إصلاحيًا (مضادًا للالتهابات) أو نمطًا عصبيًا تنكسيًا (مؤيدًا للالتهابات) يعتمد إلى حد كبير على المحفزات البيئية. واحدة من المحفزات الفريدة الموجودة في الحبل الشوكي المصاب هي حطام المايلين. عندما تصل البلعميات الكبيرة إلى الحبل الشوكي المصاب، تصبح البلعميات الرئيسية المسؤولة عن إزالة حطام المايلين. من خلال ابتلاع بقايا المايلين، تبدأ هذه الخلايا المناعية المتعددة النوى في أن تشبه من الناحية الظاهرية والهيكلية خلايا الرغوة المحملة بالدهون التي تكون شائعة في حالات مرضية أخرى، مثل تصلب الشرايين. كما تخضع خلايا MDMs لتحول ظاهري مسبب للالتهابات يترافق مع ضعف التجديد. على الرغم من أنه من المعروف جيدًا أن البلعميات تزيل حطام المايلين وتتبنى نمطًا مسببًا للالتهاب في الوقت نفسه، إلا أن الآلية البيولوجية الأساسية التي تربط بين هذين العمليتين غير واضحة.

لقد أبلغنا سابقًا أن تنشيط الفوسفوليباز A2 السيتوزولي (cPLA2) قد يربط المايلين بالتفعيل المؤيد للالتهابات. . ينتمي cPLA2 إلى عائلة كبيرة من الإنزيمات تُسمى الفوسفوليباز التي تحفز التحلل المائي للفوسفوليبيدات إلى مستقلبات دهنية نشطة حيوياً. تُقسم الفوسفوليباز إلى فئتين فرعيتين، الفوسفوليباز 1 والفوسفوليباز 2 (PLA2). لقد تم دراسة عائلة PLA2 بشكل مكثف لأنها تعمل على موضع Sn-2 من الفوسفوليبيدات لتوليد الأحماض الدهنية الحرة (للمراجعة انظر الأحماض الدهنية الحرة الناتجة عن انقسام Sn-2 للفوسفوليبيدات تكون في الغالب غير مشبعة ومتعددة وغالبًا ما تعمل كمواد سابقة للإيكوسانويدات والدوكوسانويدات. الإيكوسانويدات والدوكوسانويدات هي مجموعة من المستقلبات الدهنية النشطة حيويًا التي لها وظائف متنوعة للغاية وتلعب أدوارًا مهمة في بدء واستجابة الالتهاب وحلها. .
لقد كانت cPLA2 محورًا لعقود من البحث لأنها تستهدف بشكل محدد الفوسفوليبيدات التي تحتوي على مجموعة أراشيدونيك. حمض الأراشيدونيك هو حمض دهني غير مشبع متعدد الذي يعد سلفًا لإنتاج الإيكوسانويدات مثل البروستاجلاندينات، والبروستاسيكلينات، والثromboxanes، والليوكوترينات. تتمتع الإيكوسانويدات بأفعال فسيولوجية واسعة ومتنوعة تشمل نفاذية الأوعية الدموية، وتجنيد خلايا المناعة، والحمى، والألم، وتجمع الصفائح الدموية. . بالإضافة إلى ذلك، يتم تنشيط cPLA2 بواسطة تدفق الكالسيوم داخل الخلايا والفوسفوريلation بواسطة عدة كينازات بروتينية، بما في ذلك كينازات البروتين المنشطة بواسطة العوامل المحفزة للنمو، كيناز البروتين المعتمد على الكالمودولين II، وكينازات التفاعل مع البروتين المنشط بواسطة الميتوجين يتم تحفيز كل من الكالسيوم داخل الخلايا ونشاط كيناز البروتين بواسطة مسببات الأمراض الشائعة وأنماط الجزيئات المرتبطة بالضرر الموجودة بعد إصابة الحبل الشوكي. ت triggers تنشيط cPLA2 الانتقال إلى النوى، والميتوكوندريا، والليزوزومات، والأغشية البلازمية، حيث يعمل على الفوسفوليبيدات لتوليد حمض الأراكيدونيك الحر الذي يتم تحويله بسرعة إلى الإيكوسانويدات النشطة حيوياً. .

من هذه المعلومات، ليس من المستغرب أن تثبيط cPLA2 مفيد في العديد من عمليات المرض. تم استخدام كل من الأدوات الدوائية والجينية في العمل السابق الذي يحقق في دور cPLA2 في إصابة الحبل الشوكي (SCI) لتثبيط cPLA2. تم وصف cPLA2 لأول مرة في أنسجة الحبل الشوكي غير المصابة والمصابة بواسطة أونغ وآخرون، وليو وآخرون، على التوالي. . منذ ذلك الحين، قامت عدة تقارير بتقييم تأثير تثبيط cPLA2 على نتائج إصابات الحبل الشوكي مع نتائج متضاربة. تشير معظم هذه التقارير إلى أن تثبيط cPLA2 مفيد في التعافي من إصابات الحبل الشوكي ويظهر تحسنًا في التعافي الحركي، وزيادة في الحفاظ على الأنسجة، وتقليل في موت الخلايا العصبية، وزيادة في تدفق الالتهام الذاتي. . ومع ذلك، تشير تقارير أخرى إلى تأثير ضار لتثبيط cPLA2 لقد استخدمت الأعمال السابقة الفئران المعطلة جينياً على مستوى العالم ونظائر كيتون ثلاثي الفلوروميثيل (كيتون أراشيدونيلي ثلاثي الفلوروميثيل وكيتون بالميتويل ثلاثي الفلورو ميثيل لتقييد نشاط cPLA2 بشكل منهجي لقد وثقنا سابقًا أن cPLA2 موجود في البلعميات بعد إصابة الحبل الشوكي. . كما أظهرنا أن cPLA2 قد يلعب دورًا حاسمًا في تعزيز تنشيط البلعميات المسببة للالتهابات بواسطة المايلين في المختبر باستخدام مثبط cPLA2 في هذا التقرير، أكدنا أولاً ملاحظاتنا السابقة بشأن دور cPLA2 في تعزيز تنشيط البلعميات المسببة للالتهابات بواسطة المايلين في المختبر باستخدام بَلْعَمِيَّات مُشتقة من نقي العظام (BMDMs) غير الحاملة لـ cPLA2. بالإضافة إلى ذلك، قمنا بإنشاء فئران هجينة باستخدام متبرعين من نوع cPLA2 المعطلة (cPLA2 KO) أو من النوع البري (WT) للتحقيق في دور cPLA2 في MDMs بعد إصابة الحبل الشوكي (SCI). على الرغم من أننا حققنا تشويشًا قويًا مع انخفاض كبير في تعبير cPLA2 في الكريات البيضاء وفي أنسجة الحبل الشوكي المصابة، لم نجد أي تأثير لتشويش cPLA2 على التعافي الحركي أو الحفاظ على الأنسجة بعد إصابة الحبل الشوكي.

في هذه التجارب، إناث cPLA2 التي تتراوح أعمارها بين 2 إلى 4 أشهر تم استخدام فئران cPLA2 KO، وفئران cPLA2 +/+ (WT) كضوابط من نفس السلالة، وفئران Actin-GFP C57BL/6 كمتبرعين بخلايا جذعية دموية (HSCT). تم استخدام فئران C57BL/6 بعمر ثلاثة أشهر (مختبرات جاكسون، بار هاربر، مين) كمتلقين لزراعة خلايا جذعية دموية. تم إنتاج فئران cPLA2 KO سابقًا. “، وتم التبرع بأزواج التكاثر بسخاء من قبل الدكتور شياو-مينغ شو في كلية الطب بجامعة إنديانا وتم تأييدها من قبل الدكتور جوزيف بونفينتر (جامعة هارفارد). لتقليل خطر رفض نخاع العظام أو الأمراض ذات الصلة (مرض الطعم مقابل المضيف)، تم إعادة تهجين فئران cPLA2 KO مع إناث C57BL/6J التي تم الحصول عليها من مختبرات جاكسون. تم شراء فئران Actin-GFP في الأصل من مختبرات جاكسون ولكن تم التبرع بها بسخاء من قبل الدكتور أحمد عبد اللطيف في جامعة كنتاكي. تم إيواء جميع الحيوانات في أقفاص IVC مع الوصول الحر إلى الطعام والماء. تم تنفيذ جميع الإجراءات وفقًا للإرشادات والبروتوكولات الخاصة بمكتب نزاهة البحث ومع موافقة لجنة رعاية واستخدام الحيوانات المؤسسية في جامعة كنتاكي. امتثلت جميع الإجراءات لمعايير ARRIVE (البحث على الحيوانات: الإبلاغ عن التجارب الحية). ) إرشادات.

تم استخراج البلعميات المشتقة من نخاع العظم (BMDMs) من عظمة الفخذ وعظمة الساق من الفئران المعدلة وراثيًا cPLA2 KO والمجموعة الضابطة WT كما هو موصوف سابقًا. تم زرع BMDMs في خلايا في وسائط التمايز التي تحتوي على وسط معهد روسويل بارك التذكاري (RPMI، ثيرمو فيشر ساينتيفيك، #21870-092) المضاف إليه بن/strep (P/S، ثيرمو فيشر ساينتيفيك، #5140122)، 1% هيبس (سيغما-ألدريتش، #83264-100ML-F)، 1% غلوتا ماكس 0.001 (ثيرمو فيشر ساينتيفيك، #35050061)، 0.001% -ميركابتوإيثانول (ثيرمو فيشر ساينتيفيك، #21985023)، 10% FBS (لايف تكنولوجيز، #10082147)، و20% من السائل الفائق من خلايا sL929 (هدية كريمة من فيليب بوبوفيتش، جامعة ولاية أوهايو). السائل الفائق الم collected من خلايا sL929 يحتوي على عامل تحفيز مستعمرات البلعميات، الذي يساعد في تعزيز تمايز خلايا نخاع العظام إلى بلعميات. بعد 7 أيام من التمايز، تم نقل الخلايا إلى أطباق 12 بئرًا بكثافة خلايا في RPMI يحتوي على جلوتا ماكس، و . في اليوم الثامن، تم تحفيز الخلايا لمدة 24 ساعة باستخدام LPS ( ، إنفيفوجين، #tlrl-eblps، التحضير القياسي) و IFN- ، eBioscience #14-831163) مخفف في وسط نمو N2A (الموصوف أدناه). في وقت التحفيز، تم أيضًا معالجة الخلايا بفتات المايلين ( ، التحضير الموصوف أدناه). بعد أربع وعشرين ساعة من التحفيز، تمت إزالة السائل العلوي وتدويره في جهاز الطرد المركزي عند (جهاز الطرد المركزي فيشر ساينتيفيك أكو سبين مايكرو R)، ثم تم تطبيق هذا الوسط المشروط بالخلايا البالعة (MCM) إما مباشرة على الخلايا العصبية الخالدة (خلايا N2A) لقياس السمية الخلوية أو تم تخزينه في قبل اختبار محتوى أكسيد النيتريك باستخدام مجموعة كاشف غريس (ثيرمو فيشر ساينتيفيك # G-7921) وRPMI خالي من الفينول الأحمر.

ميالين نقاء معتدل تم تحضير المايلين، مع مساهمات صغيرة من الأكسوليمّا والأغشية الخلوية الأخرى، كما تم وصفه سابقًا. تم جمع الأدمغة من فئران C57BL/6 وتخزينها في قبل عزل المايلين. تم أولاً شطف الأدمغة وتعليقها في محلول PBS بارد مع (PBS/P/S) وتم تجانسها باستخدام الهاون الفضفاض والضيق لجهاز التجانس Dounce (DWK Life Science، #357544). تم نقل التعليق الناتج إلى أنبوب سعة 15 مل وتم ترسيبه عند 447 جرام قبل التخلص من السائل الفائق. تم إعادة تعليق الرواسب في PBS/P/S، ثم تم توزيع 5 مل من محلول بيركول بتركيز 30% (Sigma-Aldrich، #P1644-500ML) بلطف أسفل محلول المايلين لإجراء الطرد المركزي ذو الكثافة المتدرجة. ثم تم طرد الطبقات عند 447 جرام لمدة 15 دقيقة في تحت تسارع/تباطؤ لطيف. وقد نتج عن ذلك ثلاث طبقات متميزة (الطبقة القابلة للذوبان في الأعلى، والميالين في المنتصف، ورواسب بيركول/الخلايا في الأسفل). بعد إزالة الجزء القابل للذوبان، تم نقل الميالين إلى أنبوب جديد، وإعادة تعليقها في 10 مل من الماء المقطر مع ، وتم حضنه لمدة 10 دقائق في لإحداث صدمة هيبو أوسموتية لفصل الأغشية بشكل أكبر. ثم تم إعادة ترسيب المايلين عند 447 جرام وتم تعليقه في PBS/P/S وPercoll لإجراء عملية الطرد المركزي الثانية بتدرج الكثافة كما هو موضح أعلاه. ثم تم تعليق المايلين وترسيبه مرتين في PBS/P/S لإزالة بقايا الـ Percoll والملوثات القابلة للذوبان في الماء. ثم تم تقسيم المايلين المعزول وتخزينه في كانت التركيز النهائي للبروتين في محاليل المايلين المخزنة التي تم إنتاجها بواسطة هذا البروتوكول بانحراف معياري قدره مل كحدده مجموعة اختبار بروتين BCA (ثيرمو فيشر ساينتيفيك #23225). مع تطبيق حطام المايلين على BMDMs عند ، كانت الخلايا تحتوي على جرعة متوسطة من أخيرًا، لضمان أن نتائجنا لم تكن ناتجة عن تلوث بالسموم الداخلية في تحضيرات المايلين لدينا، قمنا باختبار عينات من كل دفعة من منبه المايلين (ثيرمو فيشر ساينتيفيك #88282).

لتقييم السمية العصبية لبروتينات BMDMs المنشطة، تم الحفاظ على خط خلايا الورم العصبي الفأري (Neuro-2a أو N2A، هدية من كريس ريتشاردز، جامعة كنتاكي) في وسط نمو N2A الذي يتكون من 45% DMEM، 45% وسط OPTI-MEM منخفض المصل، 10% مصل بقري جنيني (FBS)، و1% بنسلين/ستربتوميسين. تم زرع خلايا N2A بكثافة خلايا في أطباق زراعة الأنسجة ذات 96 بئرًا وتم السماح لها بالتكاثر لمدة 48 ساعة. تم تقييم السمية العصبية لوسائط الماكروفاج المشروطة (MCM) كما تم الإبلاغ عنه سابقًا. باستخدام مجموعة تحديد نمو الخلايا المعتمدة على MTT وفقًا لتعليمات الشركة المصنعة (Sigma-Aldrich CGD1-1KT). باختصار، تم استبدال وسط نمو N2A قبل 24 ساعة من الاختبار بوسط N2A خالٍ من المصل لتحفيز التمايز. في يوم الاختبار، تم استبدال هذا الوسط بـ MCM جديد، وتم حضن خلايا N2A في MCM لمدة 24 ساعة قبل إضافة بروميد ثيازوليل أزرق التترازوليوم (MTT). ) ، تم إضافة (per well) إلى كل بئر، وتمت مواصلة حضانة الخلايا لمدة ساعتين. يمكن أن يتم قطع حلقة التترازوليوم من MTT بواسطة ديهيدروجينازات الميتوكوندريا للخلايا القابلة للحياة، مما ينتج عنه بلورات الفورمازان الأرجوانية، والتي تم إذابتها بعد ذلك في مذيب الإيزوبروبانول المحمض. تم قياس المحلول الأرجواني الناتج طيفياً عند 570 نانومتر في جهاز قراءة الميكرو بلايت Epoch (BioTek Instruments, Inc., Winooski, VT) باستخدام 690 نانومتر كـ
امتصاص الخلفية. يتم تطبيع هذه البيانات إلى قيم CTL غير السامة لتوليد انخفاض نسبي في قيم البقاء.

تم قياس إنتاج أنواع الأكسجين التفاعلية (ROS) في البلعميات باستخدام الكلوروميثيل -ثنائي كلور ثنائي هيدروفلوريسئين داي أستات (CM-H2DCFDA) (إنفيتروجين-رقم الجين #C6827) كما هو موصوف سابقًا باختصار، تم زراعة BMDMs وتحفيزها كما هو موضح أعلاه باستثناء أنها كانت في لوحة 96 بئر. خلايا ). بعد التحفيز لمدة 24 ساعة، تمت إزالة السائل العلوي واستبداله بـ محلول CMH2DCFDA في RPMI خالي من الفينول الأحمر مع جلوتا ماكس والبنسلين/ستربتوميسين وتم حضنه في لمدة 25 دقيقة. تقوم الجذور الحرة بوساطة تحويل هذه المركب إلى DCF الفلوري، والذي تم الكشف عنه بواسطة قارئ الميكرو بلايت Epoch (BioTek Instruments, Inc.، وينووسكي، VT) عند طيف الإثارة/الإصدار للمركب الذي يتراوح تقريبًا بين 492-495/517-527 نانومتر.

تم قياس نشاط الأرجيناز في البلعميات الكبيرة باستخدام مجموعة اختبار نشاط الأرجيناز (ab180877). باختصار، تم زراعة بلعميات العظام المستمدة من نخاع العظام وتحفيزها كما هو موضح أعلاه. بعد إزالة السائل الفائق، تم غسل الخلايا مرتين في PBS بارد، وتم تجانسها في عازلة الفحص الباردة على الثلج باستخدام ماصة. بعد اتباع تعليمات الشركة المصنعة، تم قراءة الامتصاصات للعينات والمعايير على قارئ الميكرو بلايت عند 570 نانومتر في وضع الحركية لمدة 30 دقيقة عند 37 درجة. في هذا الفحص، تتفاعل الأرجيناز مع الأرجينين وتكون وسائط تتفاعل وتولد منتج ملون يمكن قياسه عند 570 نانومتر. باستخدام نقطتين زمنيتين في النطاق الخطي، قمنا بتحويل الكثافات الضوئية إلى نشاط إنزيمي باستخدام الصيغة المقدمة من الشركة المصنعة.

تم قياس إنتاج أكسيد النيتريك من البلعميات باستخدام مجموعة كاشف غريس (G-7921). باختصار، تم زراعة BMDMs وتحفيزها كما هو موضح أعلاه باستثناء استبدال باستخدام RPMI خالي من الفينول الأحمر، وتم تقليل التحفيزات إلى تنسيق 96 بئرًا ( خلايا ). بعد التحفيز لمدة 24 ساعة، تمت إزالة السوبرنتات وتم الطرد المركزي عند لإزالة الحطام الخلوي. بعد ذلك، تم دمج من كاشف غريس، من الماء من الدرجة الجزيئية، و من سوبرنت العينة وتم حضنها في درجة حرارة الغرفة لمدة 30 دقيقة. ثم تم تحديد التركيزات النهائية من خلال قراءة امتصاص العينة عند 548 نانومتر مقارنة بمنحنى المعايير.

لتقليل التأثيرات غير المحددة للإشعاع على الحبل الشوكي، تم إجراء دراسة جرعات أولية. تم تعريض فئران C57BL6 من النوع البري لجرعة مقسمة من 8، 10.5، أو 13 غراي من الإشعاع من نواة سيزيوم-137 المشعة. تم فصل الجرعتين النصفيتين بفترة 3 ساعات. تم عزل خلايا الجذعية الدموية (HSCs) من المتبرعين Actin-GFP، و تم إعطاؤها عن طريق الحقن خلف العين في المتلقين بعد ساعة من آخر جرعة من الإشعاع. تم الحفاظ على الفئران على الماء المضاف إليه المضادات الحيوية (40 ملغ سلفاميثوكسازول تريميثوبريم لكل 100 مل ماء) (باكتريم) لمدة أسبوع واحد قبل و4 أسابيع بعد الإشعاع. بعد ثمانية أسابيع من زراعة خلايا الجذعية الدموية (HSCT)، تم تحديد كفاءة التهجين من خلال التحليل السيتوفلوري لمستويات الكريات البيضاء الدائرة. تم جمع الدم الكامل عبر ثقب قلبي. بعد إزالة كريات الدم الحمراء عن طريق التحلل المفرط الأسموزي في كلوريد الأمونيوم وحجب Fc (BD، 553142)، تم صبغ الكريات البيضاء باستخدام CD45-APC (BD Pharmingen، 559864)، CD11b (Biolegend، 101235)، وLy6G (BD Biosciences، 560601). تم تحليل عينات الدم الملونة باستخدام BD FACSymphony، وتم إجراء التحليل باستخدام برنامج FlowJo. بالإضافة إلى ذلك، تم تقييم عدد خلايا GFP + في مقاطع كورونال من الحبل الشوكي الصدري. كما هو موضح في النتائج، فإن 10.5 غراي هو الجرعة المثلى التي تعظم كفاءة التهجين مع تقليل تسرب الكريات البيضاء إلى الحبل الشوكي. لذلك، تم استخدام جرعة 10.5 غراي للدراسات اللاحقة لـ HSCT. لتوليد هجين cPLA2 KO، تم إجراء HSCT كما هو موضح أعلاه. تم استخدام cPLA2 KO وأقارب WT كمتبرعين. تم إصابة الحيوانات أسابيع بعد HSCT. تم تحديد كفاءة التهجين عند نقاط نهاية الدراسة كما هو موضح أدناه عبر qRT-PCR.

كما هو موضح سابقًا ، تم تخدير الفئران عبر الحقن داخل البطن من الكيتامين ( ) والزلازين ( ). بعد إجراء استئصال الفقرة T9، تلقت الفئران إصابة حبل شوكي T9 بوزن 65 كدين (Infinite Horizons Impactor) . بناءً على معايير الاستبعاد المسبقة، تم اعتبار أي فأر يتلقى إصابة حبل شوكي مع شذوذ في منحنى القوة مقابل الوقت الناتج عن جهاز IH أنه تلقى “ضربة سيئة” وتم استبعاده من التحليلات (انظر الجدول 1). تشمل الشذوذات التي تستحق الاستبعاد ضربات العظام أو عدم الاستقرار في الحبل الشوكي في وقت الإصابة. بعد الإصابة، تم إغلاق شق العضلات باستخدام خياطة قابلة للامتصاص وتم إغلاق شق الجلد باستخدام خياطة أحادية الخيط. تلقت الفئران مسكن البوبرينورفين (Buprenex SR، ) والمضاد الحيوي بايتريل (إنروفلوكساسين، ) تحت الجلد مرة واحدة مباشرة بعد الجراحة بالإضافة إلى محلول ملحي (1.0 مل) ومضاد حيوي ( ) تحت الجلد لمدة 5 أيام بعد الجراحة.

تم تقييم استعادة الحركة بعد إصابة الحبل الشوكي باستخدام مقياس باسو للفئران (BMS) واختبار الحقل المفتوح، ونظام تحليل المشي CatWalk XT، واختبار السلم الأفقي. يستخدم BMS مقياس تقييم من 9 نقاط لوصف الوظائف الحركية العامة التي تتراوح من الشلل التام (الدرجة 0) إلى الوظائف الطبيعية (الدرجة 9) بينما تستكشف الفئران حقلًا مفتوحًا لمدة . تم الحصول على درجات BMS عند ، و42 dpi من قبل مراقبين اثنين غير مدركين لمجموعات العلاج. تم تقييم كل طرف خلفي بشكل منفصل بناءً على الحركة (مثل وضع الكاحل والخطوات)، والتنسيق، واستقرار الجذع. أدى متوسط درجات الطرفين الخلفيين إلى توليد درجة واحدة لكل فأر. تم اشتقاق الدرجات الفرعية لـ BMS من الملاحظات التي تم إجراؤها أثناء تسجيل درجات BMS كما هو موضح بواسطة باسو وآخرون. .

تستند الدرجات الفرعية لـ BMS إلى ميزات الحركة، مثل استقرار الجذع، والتنسيق، ووضع الكف، التي يمكن ملاحظتها في الفئران ذات الوظائف الأعلى. سمحت الدرجات الفرعية لـ BMS بدقة أفضل للتفريق بين الفئران ذات الدرجات الأعلى في BMS.

استخدمنا أيضًا نظام تحليل المشية CatWalk XT (نولدوس، فاجينينغن، هولندا) لتتبع معلمات معينة للمشية. بالنسبة لتحليل CatWalk، خضعت الفئران لثلاث جلسات اختبار: أسبوع واحد قبل الإصابة و4 و6 أسابيع بعد الإصابة. يتميز CatWalk بضوء أحمر فوق الرأس وممر مضاء باللون الأخضر، والذي يعكس الضوء استجابةً لملامسة كف الفأر الذي يتم التقاطه بعد ذلك عبر تسجيلات فيديو معايرة. تم إجراء تحليل المشية بواسطة نفس الباحث في غرفة مظلمة. باستخدام بروتوكولات التكييف والتحليل التي تم تطويرها سابقًا ، تم السماح للفئران بالتأقلم في الغرفة لمدة 30 دقيقة قبل الاختبار. بالنسبة لجولة واحدة، تم وضع الفأر أولاً في الطرف المفتوح من CatWalk تحت ضوء السقف الأحمر وسمح له بالمشي عبر الممر. أكمل كل فأر ثلاث جولات متواصلة في كل يوم تحليل، وتم الحصول على حد أدنى من ثلاث جولات صالحة، أو عبور كامل للممر، لكل موضوع. تم استبعاد التجارب التي توقف فيها الفأر، أو استدار، أو غير بشكل كبير سرعته أثناء الجولة من التحليل. تم استبعاد الفئران التي لم تكمل ثلاث جولات متواصلة بعد 25 محاولة من التحليل. تم تحليل الجولات بواسطة باحث واحد كان غير مدرك لتعيينات المجموعة.

تم استخدام اختبار السلم الأفقي لتقييم الخطوات والتنسيق في مراحل لاحقة من الاستعادة وفقًا للدراسات السابقة . تم تسجيل الفئران من الأسفل بكاميرا عالية الدقة بسرعة 60 إطارًا في الثانية أثناء عبورها 50 درجة من سلم معدني موضوعة أفقيًا. يحتوي السلم على درجات بقطر 4 مم متباعدة بمقدار 12 مم. تم وضع صندوق هروب مظلم في نهاية الدرجة الخمسين. شاهد مراقب معصوب العينين لمجموعة الإدراج التسجيلات وعدّ إجمالي أحداث انزلاق الكف الخلفي وإجمالي خطوات الكف الخلفي. تم عد انزلاقات الكف عندما سقط كف خلفي تحت درجات السلم في أي نقطة خلال دورة الخطوة. تم عد خطوات الكف الخلفي في أي وقت أعاد فيه الفأر بدء دورة خطوته. تم تطبيع انزلاقات الكف على إجمالي الخطوات التي تم اتخاذها بواسطة أي كف خلفي وتم التعبير عنها كنسبة مئوية. تم قياس ثلاث تجارب لكل فأر، وتم استخدام متوسط الثلاثة للفأر الفردي. تم تحليل التجارب بواسطة باحث واحد كان معصوب العينين عن تعيينات المجموعة.

عند نهاية الدراسة، تم إعطاء الفئران جرعة قاتلة من الكيتامين والزلازين. ثم تم جمع الدم عن طريق ثقب القلب بإبرة وسرنجية مملوءة بالهيبارين ونقلها إلى أنبوب مغطى بـ EDTA (VWR، 101094-004) لعزل الكريات البيضاء (انظر أدناه). تم ضخ الفئران عبر القلب بمحلول PBS تلاه الفورمالدهيد (PFA) في PBS (Millipore sigma). تم جمع مقطع بطول 12 مم من الحبل الشوكي الذي يمتد عبر موقع إصابة T9. تم تثبيت مقاطع الحبل الشوكي في PFA لمدة ساعتين وغسلت طوال الليل في 0.1 M PB. تم تجفيف الحبال الشوكية في السكروز لمدة أسبوع. تم حجب ستة ملليمترات من نسيج الحبل الشوكي المركز على موقع الإصابة في مركب درجة حرارة القطع المثلى (OCT) (Sakura FineTek، الولايات المتحدة الأمريكية، 4583). احتوى كل كتلة على 5 حبال شوكية ( تم اختيارها عشوائيًا لكل مجموعة). تم قطع الحبال الشوكية بالتسلسل بشكل كورونالي بسمك في الاتجاه الكورونالي. تم جمع الأنسجة على شرائح ميكروسكوبية ColorFrost Plus (Fisher Scientific). تم إنتاج عشر مجموعات من الأنسجة لكل كتلة تغطي طول الإصابة، وكانت المسافة بين كل مقطع على شريحة واحدة هي .

لتقييم حجم الإصابة، تم صبغ جميع الأنسجة بصبغة إريوكروم سيانين والنيوروفيلامين الثقيل، والتي تصبغ المايلين والأكسونات السليمة، على التوالي. تم استخدام هذه العلامات لتمييز الأنسجة المصابة عن الأنسجة السليمة. لصبغ النيوروفيلامين، خضعت المقاطع لاسترجاع المستضد في محلول سترات (pH 6.0) عند لمدة 5 دقائق. ثم تم معالجة المقاطع بـ بيروكسيد الهيدروجين في الميثانول وPBS لإخماد نشاط البيروكسيداز الداخلي. بعد ذلك، تم حجب المقاطع في مصل الماعز العادي في PBS مع Triton-X 100 لمدة ساعة واحدة. تم صبغ المقاطع طوال الليل عند باستخدام النيوروفيلامين-200 كيلودالتون (1:1,500: Ck x NF200; NFH; Aves Labs). تم غسل المقاطع في PBS تلاها حضانة لمدة ساعة واحدة مع مضاد الدجاج البيوتيني ( , BA9010، مختبرات فيكتور). ثم تم حضانة المقاطع في محلول مركب أفيدين-بيوتين (ABC؛ 1:200؛ PK6100؛ مختبرات فيكتور) وتم تطويرها باستخدام 3,3′-ديامينوبنزيدين (DAB). تم صبغ المقاطع المضادة بإريوكروم سيانين لتصور المادة البيضاء المحفوظة. تم تجفيف الشرائح الملونة باستخدام إيثانول متدرج
التخفيفات، وتم تنظيفها باستخدام Histoclear (101412-878؛ VWR Scientific)، وتم تغطيتها باستخدام Permount (SP15500؛ Fisher Scientific). تم تصوير الشرائح باستخدام Axioscan (نموذج Z1، Carl Zeiss AG.، Oberkochen، GE) بتكبير 20x وتم تصورها وقياسها باستخدام برنامج Halo (Indica Labs، Albuquerque، NM).

عند نهاية الدراسة، تم جمع الدم المحيطي من جميع الفئران عبر ثقب القلب. تم إزالة كريات الدم الحمراء باستخدام محلول تحلل كريات الدم الحمراء (RBC) (BioLegend، 420301). تم خلط الدم الم collected مع محلول تحلل كريات الدم الحمراء وتركه في درجة حرارة الغرفة لمدة 5 دقائق. تم ترسيب الكريات البيضاء بواسطة الطرد المركزي عند 350 جرام لمدة 5 دقائق، وتم تكرار عملية التحلل مرتين. تم تجميد كريات الدم البيضاء على الثلج الجاف. تم عزل RNA من كريات الدم البيضاء باستخدام مجموعة RNeasy mini (Qiagen، 74104). تم تحديد تركيز RNA باستخدام جهاز Nanodrop (Nanodrop Lite؛ Thermo Fisher Waltham، MA). تم إعداد مكتبات cDNA باستخدام مجموعة النسخ العكسية عالية السعة (Applied Biosystems، 4368814). تم إجراء qRT-PCR باستخدام مزيج SYBR الأخضر الرئيسي والمجموعة التالية من البادئات الأمامية والعكسية: (pla2g4a الأمامية= “GATTCTGGAAATGTCTCTG GAAG”، العكسية=”GGCTGACATTTTTCATTAGCTC”؛ GAPDH، الأمامية=”CATCACTGCCACCCAGAAGA CTG “، العكسية=”ATGCCAGTGAGCTTCCCGTTCAG “).

تم إجراء تحليل التعبير الجيني NanoString على مستحلب الحبل الشوكي بالكامل. بعد سبعة أيام من إصابة الحبل الشوكي، تم ضخ الفئران عبر القلب بمحلول PBS، وتم إزالة 6 مم من الحبل الشوكي وتجميده بسرعة في النيتروجين السائل. تم عزل RNA من الحبال الشوكية باستخدام مجموعة RNeasy mini (Qiagen، 74104). تم تحديد تركيز RNA باستخدام جهاز NanoDrop Lite (Thermo Fisher Waltham، MA)، وتم تخفيف العينات إلى . تم إجراء تحليل RNA باستخدام Nanostring nCounter (nCounter SPRINT profiler؛ تقنيات NanoString؛ سياتل، WA)، المتاحة في مختبر الجينوميات بجامعة كنتاكي. تم استخدام مجموعة رموز الالتهاب العصبي لاستجواب تغييرات التعبير في الجينات المرتبطة بعمليات الإصابة الثانوية التي تحدث بعد إصابة الحبل الشوكي.

تم إجراء جميع الاختبارات الإحصائية باستخدام برنامج GraphPad Prism (v9.4.1، بوسطن، MA). تم تحليل جميع البيانات في المختبر باستخدام ANOVA العادية ذات الاتجاه الواحد تلاها اختبار المقارنات المتعددة Tukey. تم استخدام اختبار t لطلاب غير المقترنين لمقارنة تعبير cPLA2 بين cPLA2 KO و WT chimeras. بالنسبة لبيانات السلوك والتحليل النسيجي، تم استخدام ANOVA ذات الاتجاهين المتكررة. تمت مقارنة بيانات السلوك على مر الزمن، وتمت مقارنة البيانات النسيجية على مسافة من المركز. اعتبرت ذات دلالة.

في سياق إصابة الحبل الشوكي، تتعرض البلعميات المشتقة من نخاع العظام (BMDMs) لمجموعة من المحفزات التي تعزز نمطًا التهابيًا . بالإضافة إلى ذلك، توجد حطام المايلين في موقع الإصابة. سابقًا، حددنا أن BMDMs في المختبر يمكن استخدامها للتنبؤ باستجابات البلعميات داخل الحبل الشوكي . هنا، استخدمنا نموذجًا في المختبر من BMDMs المشتقة من الفئران cPLA2 KO و WT للتحقيق في دور cPLA2 في التحفيز المشترك الالتهابي (LPS + IFN أو M1) والمايلين. لم يتم ملاحظة اختلافات كبيرة بين خلايا cPLA2 و WT في ظل ظروف السيطرة (التحفيز M1 فقط، الشكل 1). كما أبلغنا سابقًا , أنتجت BMDMs كميات أكبر بكثير من أنواع الأكسجين التفاعلية (ROS) وحمض النيتريك عند تحفيزها بمزيج من المحفزات M1 مع المايلين مقارنةً عند تحفيزها بمفردها (الشكل 1AB). كان هذا التأثير التراكمي لـ M1 + المايلين على إنتاج ROS وحمض النيتريك أقل بكثير في البلعميات الناقصة cPLA2 مقارنةً بالتحكمات WT (الشكل 1A-B). تم تقييم السمية العصبية الناتجة عن البلعميات من خلال قياس حيوية (اختبار MTT) خلايا N2A العصبية المعالجة بوسائط البلعميات المشروطة (MCM) المعزولة من BMDMs المحفزة. كانت MCM من البلعميات المحفزة بـ M1 + المايلين أقل سمية عصبية بشكل ملحوظ من تلك التي من التحكمات WT المحفزة بـ M1 + المايلين (الشكل 1C). بالإضافة إلى ذلك، لم تصل السمية العصبية من MCM من البلعميات المعالجة بـ M1 + المايلين إلى دلالة مقارنةً بالبلعميات المحفزة بـ M1 (الشكل 1C). كانت نشاط الأرجيناز غير متغيرة في جميع المجموعات بغض النظر عن جينوم cPLA2 والعلاج (الشكل 1D). بشكل جماعي، تشير هذه البيانات إلى دور cPLA2 في تعزيز المايلين لتحفيز تنشيط البلعميات الالتهابية والسمية العصبية.

لاختبار ما إذا كان cPLA2 يعزز تنشيط البلعميات الالتهابية في الجسم الحي، استخدمنا نموذج الفأر الهجين. قمنا أولاً بإجراء تجربة تجريبية لتحسين جرعة الإشعاع في بروتوكول HSCT الخاص بنا. كان هدفنا هو تحقيق تشبع قوي لنخاع العظام مع تقليل تسلل خلايا المناعة إلى الجهاز العصبي المركزي السليم. تم حقن خلايا جذعية دموية (HSCs) معزولة من فئران Actin-GFP عن طريق الحقن خلف العين في فئران C57BL/6J بعد ثلاث جرعات مختلفة من الإشعاع ( ، و 13 غي). بعد عشرة أسابيع من زراعة الخلايا الجذعية المكونة للدم، تم تقييم تشيؤ الكريات البيضاء وتسلل خلايا المناعة في الحبل الشوكي باستخدام قياس التدفق وميكروسكوبية المناعة الفلورية، على التوالي. كانت نسبة GFP CD45 الكريات البيضاء وGFP CD45 CD11b لي6 زادت خلايا النخاع في نمط يعتمد على الجرعة (الشكل 2A-F). بالإضافة إلى ذلك، GFP زادت الخلايا في نسيج الحبل الشوكي أيضًا بشكل متناسب مع الجرعة، مع أعلى جرعة إشعاعية (13 غيغا)، مما أدى إلى إنتاج المزيد بشكل ملحوظ من GFP داخل النسيج. خلايا المناعة في الحبل الشوكي غير المصاب مقارنة بالفئران التي تلقت 10.5 غي (الشكل 2G-I). باختصار، فإن جرعة 10.5 غي حققت تقريبًا تحويل الكريات البيضاء الدائرة (الشكل 2C) وLy6G خلايا نقي العظام (الشكل 2F) مع تسلل طفيف في الحبل الشوكي. لذلك، تم استخدام 10.5 غيغا من الإشعاع في تجارب الكيميرا اللاحقة.

مكن بروتوكول زراعة الخلايا الجذعية المحسّن لدينا من استجواب دور cPLA2 في الخلايا الضامة بعد إصابة الحبل الشوكي. تلقت فئران C57BL6/J البرية خلايا جذعية من متبرعين من نوع cPLA2 KO و WT بعد 10.5 جراي. بعد 8 إلى 12 أسبوعًا من زراعة الخلايا الجذعية، تلقت الفئران إصابة حبل شوكي من نوع T9 بضغط 65 كدين، وتم جمع الأنسجة بعد 7 أيام أو 6 أسابيع من الإصابة (الشكل 3A-B). تم جمع الدم الكامل في نقاط نهاية الدراسة، وتم قياس تعبير cPLA2 في الكريات البيضاء المعزولة. في جميع المجموعات الثلاث، كان تعبير cPLA2 منخفضًا تقريبًا بمقدار عشرة أضعاف في الحيوانات التي تلقت خلايا جذعية KO مقارنةً بتلك التي تلقت خلايا جذعية WT (الشكل 3B-C) (B، ; ج، ). بالإضافة إلى ذلك، فإن الإزالة الانتقائية لـ cPLA2 في خلايا MDM المتسللة

كان كافياً لتقليل تعبير cPLA2 بشكل كبير في الحبل الشوكي بعد 7 أيام، مما يؤكد فعالية نهج KO الخاص بنا (الشكل 3D) ( ).

لاختبار الفرضية القائلة بأن MDM cPLA2 يحد من التعافي الحركي بعد إصابة الحبل الشوكي، قمنا بتقييم التعافي الحركي لخلائط cPLA2 KO وخلائط WT كضوابط باستخدام درجة BMS، ودرجة BMS الفرعية، وسلّم السلم الأفقي، ونظام تحليل المشي CatWalkXT. أشارت درجات BMS والدرجات الفرعية إلى التعافي من الشلل الكامل مع بعض حركة الكاحل فقط (درجة 1 و 2) بعد يوم واحد من الإصابة (DPI) إلى خطوات plantar المتكررة والمتسقة مع خطوات منسقة بعد 6 أسابيع من الإصابة (WPI) (درجة سمح تصنيف BMS الفرعي بالتمييز بين الحيوانات ذات الوظائف الأعلى وأظهر تعافيًا ملحوظًا في الحركة خلال فترة المراقبة التي استمرت ستة أسابيع. كانت درجات BMS والدرجات الفرعية التي لوحظت عند 4 أسابيع بعد الإصابة متسقة مع الدراسات السابقة على الفئران غير المعرضة للإشعاع التي تلقت إصابة في الحبل الشوكي معتدلة. . على عكس فرضيتنا، لم تشير درجات BMS أو الدرجات الفرعية إلى تغيير في استعادة الحركة في شيميرات cPLA2 KO مقارنةً بشيميرات WT كضوابط (الشكل 4A-B) (درجات BMS، ; الدرجات الفرعية، ). نظرًا لأن هذه الفئران كانت قادرة على المشي المدعوم بالوزن، قمنا بإجراء اختبار عارضة السلم الأفقي لتقييم استعادة الأطراف الخلفية، حيث إنه أكثر حساسية لاستعادة المشي والتنسيق من تقييم BMS وحده. تم إجراء اختبار السلم الأفقي مرة واحدة فقط في 6 أسابيع بعد الإصابة للحد من التكيف والتدريب على الاختبار. أظهر تقييم وظيفة الأطراف الخلفية من خلال اختبار شعاع السلم الأفقي عدم وجود اختلافات كبيرة في استعادة الحركة بين الفئران المعدلة وراثيًا cPLA2 KO وشهود التحكم WT (الشكل 4C). .

تم إجراء تحليل مشية CatWalk قبل الإصابة وبعد 4 و 6 أسابيع من الإصابة. باستخدام CatWalk XT، قمنا بتقييم مؤشر الانتظام، وقاعدة الدعم، وطول الخطوة، ومساحة الطباعة كقياسات مستمرة حساسة لإصابات الحبل الشوكي المتوسطة والشديدة. كان مؤشر الانتظام، وهو مقياس للتنسيق، قد انخفض بشكل ملحوظ بعد 4 أسابيع. لكنها زادت إلى مستويات قريبة من مستويات ما قبل الإصابة بعد 6 أسابيع، مما يعكس الزيادة في درجة BMS والدرجات الفرعية في نفس الإطار الزمني. لم يكن لدى الكيميرات التي تعاني من نقص cPLA2 فرق كبير في مؤشر الانتظام مقارنةً بالتحكم WT في أي من النقاط الزمنية الثلاث التي تم تقييمها (الشكل 4D). ، يتم قياس قاعدة دعم الكف الخلفي المسافة بين الكفين الخلفيين خلال دورة خطوة واحدة وقد انخفضت عند كل من 4 و 6 أسابيع بعد الإصابة. لم يكن هناك فرق ذو دلالة إحصائية بين المجموعتين في أي من نقطتي الزمن (الشكل 4E). يقيس طول خطوة القدم الخلفية المسافة التي تقطعها قدم واحدة بين الخطوات. على الرغم من أن طول خطوة القدم الخلفية كان مستقراً نسبياً بين 4 و 6 أسابيع بعد الإصابة، لم يكن هناك فرق ذو دلالة إحصائية بين الكيميرات التي تحمل جين cPLA2 KO والشواهد البرية (الشواهد WT) (الشكل 4F). أخيرًا، منطقة بصمة الكف الخلفي تقيس الحد الأقصى لمنطقة بصمة الكف خلال حدث التثبيت. لم تنخفض منطقة بصمة الكف الخلفي بعد الإصابة ولم تكن هناك اختلافات بين المجموعات في أي من نقطتي الزمن (الشكل 4G). .

في نهاية الأسابيع الستة، تم جمع الأنسجة لتقييم تأثير تشكل الكيميرا cPLA2 KO على علم الأمراض النسيجية بعد إصابة الحبل الشوكي. باستخدام صبغة إريوكروم سيانين (EC) وصبغة الألياف العصبية الثقيلة (NF)، تم تحديد الأنسجة المحفوظة على أنها محاور م myelinated مزدوجة الإيجابية (EC+، NF+). توضح صور مركز الإصابة التمثيلية تباينًا واضحًا بين مناطق الأنسجة المحفوظة ومناطق الإصابة الواضحة في نسيج الحبل الشوكي (الشكل 5A-B). لم يكن هناك اختلاف كبير في حفظ الأنسجة عند مركز الإصابة أو أمامه وخلفه بين الكيميرات cPLA2 KO و WT (الشكل 5D-E) (5E، قمنا أيضًا بتحديد نمو المحاور العصبية داخل الآفة لأن دراسات أخرى تتلاعب بخلايا MDM في إصابة الحبل الشوكي قد أظهرت أن المحاور العصبية داخل الآفة تتأثر. قمنا بقياس نمو المحاور العصبية داخل الآفة من خلال تحديد نسبة المساحة الكلية الإيجابية للألياف العصبية في مركز الآفة و روسترا وذيلًا إلى المركز (الشكل 5C). لم يكن هناك فرق في المحاور العصبية المحفوظة داخل الآفة بين الكيميرات من نوع cPLA2 KO و WT في المقاطع التي تم تقييمها. ، ) (الشكل 5F).

البيئة الميكروبية الالتهابية التي تستمر بشكل مزمن في الحبل الشوكي المصاب تحد من التعافي. الآليات الأساسية التي تحرك الالتهاب بعد إصابة الحبل الشوكي غير مفهومة جيدًا. قد تكون البلعميات المحملة بالحطام الدهني التي تبقى بشكل مزمن في موقع الإصابة هي المسؤولة. الدراسات السابقة التي أجراها مختبرنا وآخرون قد

أظهر أن المايلين يمكن أن يحفز نمط ظاهري للبلاعم المؤيدة للالتهابات تشير أعمالنا السابقة إلى أن إنزيمات PLA2 ضرورية لتعزيز النمط الظاهري للماكروفاج المؤيد للالتهابات الناتج عن المايلين. في هذه الدراسة، أكدنا عملنا السابق في المختبر باستخدام ماكروفاجات KO لـ cPLA2 بدلاً من مثبط كيميائي غير محدد. مما يؤكد أن cPLA2 وحده كان كافياً لتعزيز التنشيط الالتهابي المعتمد على المايلين. في الجسم الحي، كانت الفئران الهجينة التي تفتقر إلى cPLA2 تعاني من تعافي مشابه وحفظ الأنسجة بعد إصابة الحبل الشوكي مقارنةً بالتحكمات الهجينة من النوع البري. تشير نتائجنا إلى أن cPLA2 لا يلعب نفس الدور في الخلايا المناعية المتغصنة في الجسم الحي كما هو الحال في نموذجنا في المختبر للبيئة الغنية بالدهون لإصابة الحبل الشوكي.
cPLA2 يتم دراسته على نطاق واسع في العديد من الأمراض وهو إنزيم رئيسي في إنتاج حمض الأراكيدونيك . وبالتالي، كانت cPLA2 هدفًا علاجيًا محتملاً لإصابة الحبل الشوكي لمدة تقارب العقدين. استخدمت عدة دراسات تقنيات دوائية وجينية لتثبيط cPLA2 مع نتائج متباينة. كانت أول تقرير من قبل هوانغ وآخرين قد أعطى جرعة واحدة من مثبط cPLA2، بعد إصابة الحبل الشوكي وأظهرت تحسنًا في التعافي الحركي وبقاء الخلايا العصبية خلال الأسبوع الأول .

بعد ذلك، أبلغت دراسة شاملة لجميع إنزيمات PLA2 التي تم تنظيمها بعد إصابة الحبل الشوكي بواسطة لوبيز-فاليس وآخرين عن انخفاض في التعافي السلوكي وتفاقم في علم الأمراض النسيجي بعد تثبيط cPLA2 باستخدام مثبط انتقائي وقوي قائم على 2-أوكزاميد وفأر knockout عالمي لـ cPLA2. . وقد اقترح هذا التقرير أيضًا أن أنواع أخرى من PLA2، مثل الفوسفوليبازات السرطانية والفوسفوليبازات المستقلة عن الكالسيوم (sPLA2 و iPLA2)، كانت مرضية وأن نشاط cPLA2 كان مفيدًا. وقد أفادت الأبحاث من مختبر الدكتور شياو-مينغ شو بأن تثبيط cPLA2 من خلال الاستمرار في إدارة في الجرذان والإزالة الجينية العالمية في الفئران حسنت من التعافي السلوكي وحفظ الأنسجة في دراسات لاحقة، أظهرت مجموعته أن تثبيط cPLA2 يقلل من نشاط RhoA/Rho kinase والعكس صحيح. تنشيط RhoA/Rho kinase هو حاجز رئيسي أمام التجديد بعد إصابة الحبل الشوكي، حيث يؤدي إلى انهيار مخروط النمو وتراجع المحاور العصبية. . مؤخرًا، أفاد مختبره أن تثبيط cPLA2 يقلل من فقدان الخلايا العصبية الحركية وضمور العضلات بعد . أخيرًا، أفاد لي وآخرون أن استعادة البلعمة الذاتية غير الوظيفية بعد إصابة الحبل الشوكي بشكل عام، تشير هذه التقارير، جنبًا إلى جنب مع بياناتنا، إلى دور معقد لـ cPLA2 في الإصابة الثانوية وعلم الأمراض العصبية بعد إصابة الحبل الشوكي.

في إصابة الحبل الشوكي، قد لا يساهم cPLA2 من نوع MDM في الإصابة الثانوية لأن معظم cPLA2 النشط يوجد في الخلايا العصبية، والأستروسيت، والميكروغليا. الدراسات المبكرة حددت الخلايا العصبية الإيجابية لـ cPLA2 في مناطق معينة من الدماغ والحبل الشوكي.
عصبونات الحبل الشوكي في الجهاز العصبي المركزي للجرذان غير المصابة مع إشارات خافتة فقط في الخلايا الدبقية . أبلغت الدراسات اللاحقة عن وجود تفاعل مناعي لـ cPLA2 في نماذج القوارض للاحتشاء الدماغي البؤري والعالمي ومرض التصلب الجانبي الضموري، بالإضافة إلى أنسجة الدماغ من مرض الزهايمر كان cPLA2 موجودًا في مناطق موت الخلايا العصبية ولكنه كان أيضًا موجودًا في الخلايا النجمية التفاعلية والميكروغليا المحيطة. في إصابة الحبل الشوكي، كان يُعتقد أن cPLA2 يُعبر عنه فقط في الخلايا العصبية، والخلايا الدبقية قليلة التغصن، وطبقة فرعية من الخلايا الدبقية الصغيرة. مؤخراً، كشفت أساليب أكثر حساسية للكشف عن تعبير cPLA2 باستخدام عدّ RNA في الخلايا المفروزة وعلم الجينوم الفردي عن تعبير cPLA2 في الخلايا الدبقية الصغيرة، والخلايا الوحيدة النواة المستمدة من الدم، والخلايا البطانية خلال الأسبوع الأول بعد الإصابة. ومع ذلك، من المهم أن نلاحظ أن cPLA2 يتم تنشيطه بواسطة الكالسيوم داخل الخلايا والفوسفوريلation المعتمدة على بروتين كيناز المحفز بواسطة الميتوجين؛ وبالتالي، فإن الكشف القائم على الأجسام المضادة والأحماض النووية ليس كافياً لتحديد نشاط cPLA2 وإنتاج حمض الأراكيدونيك المصاحب. وبالتالي، ستحدد تجربة نشاط cPLA2 المحددة للخلايا الهدف الأكثر احتمالاً لتثبيط cPLA2 بعد إصابة الحبل الشوكي. بدلاً من ذلك، يمكن إنشاء “كيميرا عكسية” حيث يتم زرع نخاع العظم البري في فئران KO لـ cPLA2. ستوضح هذه الأساليب بشكل أكبر دور MDM cPLA2 في الإصابة الثانوية بعد إصابة الحبل الشوكي.

بدلاً من ذلك، قد يكون MDM cPLA2 ضارًا للتعافي، لكن التأثير المفيد لحذف MDM cPLA2 قد يت overshadowed بحذف cPLA2 في خلايا أخرى مشتقة من HSC، وهي الصفائح الدموية. تثبيط cPLA2 في الصفائح الدموية مع يقلل من إنتاج الثromboxane A2، المعروف أيضًا باسم عامل تنشيط الصفائح الدموية (PAF) بالإضافة إلى ذلك، فإن الفئران التي تفتقر إلى cPLA2 لديها انخفاض في تجلط الصفائح الدموية وزيادة في أوقات النزيف. من المحتمل أن تكون الكيميرات الخاصة بنا التي تفتقر إلى cPLA2 تحتوي على صفائح دموية ناقصة لـ cPLA2. قد تكون الصفائح الدموية المفقودة من cPLA2 KO قد كانت ذات فعالية محدودة في التجلط بشكل حاد بعد إصابة الحبل الشوكي، مما أدى إلى تفاقم النزيف. يؤثر مدى النزيف بعد إصابة الحبل الشوكي على التعافي ليس فقط في القوارض ولكن أيضًا في البشر. يمكن أن يتنبأ النزيف المقاس بواسطة التصوير الشعاعي بالنتائج في حالات إصابة الحبل الشوكي. لذلك، قد تكون أي آثار مفيدة لـ MDM cPLA2 KO قد تم تعويضها من خلال النزيف المتفاقم. قد تتمكن التجارب المستقبلية من الحد من تثبيط cPLA2 غير المحدد من خلال استخدام الحذف الانتقائي بواسطة Cre من الخلايا الدبقية الصغيرة وMDMs.

تظهر نتائجنا أن cPLA2 في MDMs من المحتمل ألا تساهم بشكل كبير في الأمراض التي تسببها البلعميات بعد إصابة الحبل الشوكي. لقد أظهرنا أولاً أن البلعميات التي تعاني من نقص cPLA2 محمية من التأثير المعزز للالتهابات الناتج عن المايلين. باستخدام شجرات نخاع العظام، قمنا بعد ذلك بالتحقيق في دور cPLA2 في MDMs بعد إصابة الحبل الشوكي. لم نجد أي تأثير لنقص cPLA2 في زراعة خلايا الدم الجذعية على التعافي الحركي أو علم الأمراض النسيجية. تكشف هذه الاكتشافات عن سلسلة من الملاحظات غير المتجانسة باستخدام نقص عالمي أو قمع cPLA2 في إصابة الحبل الشوكي.

جميع البيانات الخام المقدمة في الأشكال والجداول هنا متاحة للجمهور من خلال بيانات مفتوحة لمؤسسة إصابة الحبل الشوكي (ODC-SCI). ODC-SCI هو بوابة ومخزن مخصص لمشاركة البيانات في مجال إصابة الحبل الشوكي يتيح مشاركة البيانات مع الجمهور باستخدام DOI. DOI المرتبط بهذا العمل هو كما يلي: http://dx.doi.org/10.34945/F52307. ODC-SCI يتوافق مع مبادئ بيانات FAIR لضمان أن بيانات إصابة الحبل الشوكي قابلة للاكتشاف، والوصول، والتشغيل البيني، وإعادة الاستخدام.

تاريخ الاستلام: 6 سبتمبر 2024؛ تاريخ القبول: 30 ديسمبر 2024
تم النشر عبر الإنترنت: 02 يناير 2025

نود أن نشكر الدكتور شياو-مينغ شو على تبرعه السخي بفئران cPLA2 KO. كما نود أن نشكر الدكتور سينثيلناثان بالانياندي والدكتور جوش مورغانتي على مساعدتهما التقنية.

التصور: E.G.، T.K.، J.G. المنهجية: E.G.، T.K.، J.G. التحقق: E.G. التحليلات الرسمية: E.G.، T.K. التحقيق: E.G.، T.K.، W.B.، R.K.، A.S.، H.K. تنسيق البيانات: E.G. الكتابة: E.G. المراجعة والتحرير: E.G.، J.G.، T.K. إدارة المشروع: E.G.، J.G. الحصول على التمويل: E.G.، T.K.، و J.G. الإشراف: J.G.

تم تقديم دعم التمويل من قبل: مؤسسة كريغ إتش نيلسن بموجب الجائزة #651996، والمعهد الوطني للاضطرابات العصبية والسكتة الدماغية (NINDS) التابع للمعاهد الوطنية للصحة (NIH) بموجب الجوائز: F31NS105443، F30NS129251 و R01NS116068.

يعلن المؤلفون عدم وجود مصالح متنافسة.

يجب توجيه المراسلات وطلبات المواد إلى J.C.G.
معلومات إعادة الطبع والتصاريح متاحة على www.nature.com/reprints.
ملاحظة الناشر تظل Springer Nature محايدة فيما يتعلق بالمطالبات القضائية في الخرائط المنشورة والانتماءات المؤسسية.

الوصول المفتوح هذه المقالة مرخصة بموجب رخصة المشاع الإبداعي للاستخدام غير التجاري، والتي تسمح بأي استخدام غير تجاري، ومشاركة، وتوزيع، وإعادة إنتاج في أي وسيلة أو صيغة، طالما أنك تعطي الائتمان المناسب للمؤلفين الأصليين والمصدر، وتوفر رابطًا لرخصة المشاع الإبداعي، وتوضح إذا قمت بتعديل المادة المرخصة. ليس لديك إذن بموجب هذه الرخصة لمشاركة المواد المعدلة المشتقة من هذه المقالة أو أجزاء منها. الصور أو المواد الأخرى من طرف ثالث في هذه المقالة مشمولة في رخصة المشاع الإبداعي للمقالة، ما لم يُشار إلى خلاف ذلك في سطر الائتمان للمادة. إذا لم تكن المادة مشمولة في رخصة المشاع الإبداعي للمقالة واستخدامك المقصود غير مسموح به بموجب اللوائح القانونية أو يتجاوز الاستخدام المسموح به، ستحتاج إلى الحصول على إذن مباشرة من صاحب حقوق الطبع والنشر. لعرض نسخة من هذه الرخصة، قم بزيارة http://creativecommo ns.org/licenses/by-nc-nd/4.0/.
© المؤلفون 2025

Spinal cord injury (SCI) leads to permanent motor and sensory loss that is exacerbated by intraspinal inflammation and persists months to years after injury. After SCI, monocyte-derived macrophages (MDMs) infiltrate the lesion to aid in myelin-rich debris clearance. During debris clearance, MDMs adopt a proinflammatory phenotype that exacerbates neurodegeneration and hinders recovery. The underlying cause of the lipid-mediated MDM phenotype shift is unclear. Our previous work suggests that cytosolic phospholipase A2 (cPLA2) plays a role in the proinflammatory potentiating effect of myelin on macrophages in vitro. Cytosolic phospholipase A2 (cPLA2) frees arachidonic acid from phospholipids, generating eicosanoids that play an important role in inflammation, immunity, and host defense. cPLA2 is expressed in macrophages along with multiple other cell types after SCI, and cPLA2 inhibition has been reported to both reduce and exacerbate secondary injury pathology recovery. The role of cPLA2 in MDMs after SCI is not fully understood. We hypothesize that cPLA2 activation in MDMs after SCI contributes to secondary injury. Here, we report that cPLA2 plays an important role in the myelin-induced inflammatory macrophage phenotype in vitro using macrophages derived from cPLA2 knockout bone marrow. Furthermore, to investigate the role of cPLA2 in MDMs after SCI, we generated female bone marrow chimeras using cPLA2 knock-out donors and assessed locomotor recovery using the Basso Mouse Scale (BMS), CatWalk gait analysis system, and horizontal ladder task over six weeks. We also evaluated tissue sparing and intralesional axon density six weeks after injury. cPLA2 KO chimeras did not display altered locomotor recovery or tissue pathology after SCI compared to WT chimera controls. These data suggest that although cPLA2 plays a critical role in myelin-mediated potentiation of proinflammatory macrophage activation in vitro, it may not contribute to secondary injury pathology in vivo after SCI.

Keywords Spinal cord injury, Cytosolic phospholipase A2, Macrophage, Myelin, Inflammation

Spinal cord injury (SCI) is a devastating condition that results in significant functional deficits and dramatically decreases the quality of life of injured individuals. The initial mechanical trauma to the spinal cord tissue, known as primary injury, is followed by biological events that exacerbate tissue damage. This secondary injury involves a complex biological cascade that includes but is not limited to inflammation, activation of resident neuroglia, peripheral leukocyte infiltration, and oxidative stress. Secondary injury exacerbates tissue damage and hinders recovery thereby limiting endogenous repair .

In the injured spinal cord, activated macrophages, made up of resident microglia and infiltrating monocytederived macrophages (MDMs), play a large role in the secondary injury response and contribute to both injury and repair . Whether macrophages adopt a reparative (anti-inflammatory) or neurodegenerative (proinflammatory) phenotype is largely due to environmental stimuli. One unique stimulus found in the injured spinal cord is myelin debris. As MDMs arrive in the injured spinal cord, they become the primary phagocytes responsible for myelin debris clearance . Through engulfment of myelin debris, these MDMs begin to phenotypically and morphologically resemble lipid-laden foam cells that are common in other disease states, such as atherosclerosis . MDMs also undergo a concomitant proinflammatory phenotypic shift that impairs regeneration . Although it is well established that macrophages clear myelin debris and adopt a proinflammatory phenotype simultaneously, the underlying biological mechanism linking these two processes is unclear.

We previously reported that activation of cytosolic phospholipase A2 (cPLA2) may link myelin with proinflammatory activation . cPLA2 belongs to a superfamily of enzymes called phospholipases that catalyze the hydrolysis of phospholipids into bioactive lipid metabolites. Phospholipases are split into two subcategories, phospholipase 1 and phospholipase 2 (PLA2). The PLA2 family has been extensively studied because it acts on the Sn-2 position of phospholipids to generate free fatty acids (for a review see ). Free fatty acids generated from Sn-2 cleavage of phospholipids are largely polyunsaturated and often serve as precursors to eicosanoids and docosanoids. Eicosanoids and docosanoids are a group of bioactive lipid metabolites that have extremely diverse functions and play important roles in the initiation and resolution of the inflammatory response .
cPLA2 has been the focus of decades of research because it specifically targets phospholipids containing an arachidonic acid acyl moiety. Arachidonic acid is a polyunsaturated fatty acid that is the precursor for the production of eicosanoids such as prostaglandins, prostacyclins, thromboxanes, and leukotrienes. Eicosanoids have widespread and diverse physiological actions that include vascular permeability, immune cell recruitment, fever, pain, and platelet aggregation . Additionally, cPLA2 is activated by intracellular calcium influx and phosphorylation by several protein kinases, including mitogen-activated protein kinases, calmodulindependent protein kinase II, and mitogen-activated protein interacting kinases . Both intracellular calcium and protein kinase activity are triggered by common pathogens and damage-associated molecular patterns found after SCI . cPLA2 activation triggers translocation to nuclear, mitochondrial, lysosomal, and plasma membranes, where it acts on phospholipids to generate free arachidonic acid that is quickly converted to bioactive eicosanoids .

From this information, it is not surprising that cPLA2 inhibition is beneficial in numerous disease processes . Previous work investigating the role of cPLA2 in SCI utilized both pharmacologic and genetic tools to inhibit cPLA2. cPLA2 was first described in uninjured and injured spinal cord tissue by Ong et al. and Liu et al., respectively . Since then, several reports have assessed the effect of cPLA2 inhibition on SCI outcomes with conflicting results. Most of these reports suggest that cPLA2 inhibition is beneficial to SCI recovery and shows improved locomotor recovery, increased tissue sparing, reduced neuronal death, and enhanced autophagic flux . However, other reports indicate a detrimental effect of cPLA2 inhibition . Previous work has used global-knockout mice and trifluoromethyl ketone analogs (arachidonyl trifluoromethyl ketone and palmitoyl trifluoromethyl ketone to systemically limit cPLA2 activity . We previously documented that cPLA2 is present in macrophages after SCI . We also demonstrated that cPLA2 may play a critical role in myelin-mediated potentiation of proinflammatory macrophage activation in vitro using the cPLA2 inhibitor . In this report, we first confirmed our previous observations regarding the role of cPLA2 in myelin-mediated potentiation of proinflammatory macrophage activation in vitro using cPLA2 KO bone marrow-derived macrophages (BMDMs). Additionally, we generated chimeric mice using cPLA2 knock-out (cPLA2 KO) or wild-type (WT) littermate control donors to interrogate the role of cPLA2 in MDMs after SCI. Although we achieved robust chimerism with dramatically decreased cPLA2 expression in leukocytes and in injured spinal cord tissue, we found no effect of cPLA2 chimerism on locomotor recovery or tissue sparing after SCI.

In these experiments, 2 – to 4 -month-old female cPLA2 (cPLA2 KO), cPLA2 +/+ (WT) littermate controls, and Actin-GFP C57BL/6 mice were used as hematopoietic stem cell transplant (HSCT) donors. Three-monthold C57BL/6 mice (Jackson Labs, Bar Harbor, Maine) were used as HSCT recipients. cPLA2 KO mice were previously generated , and breeding pairs were generously donated by Dr. Xiao-Ming Xu at the Indiana University School of Medicine and endorsed by Dr. Joseph Bonventre (Harvard University). To reduce the risk of bone marrow rejection or related pathologies (graft versus host disease), cPLA2 KO mice were backcrossed to C57BL/6J females acquired from Jackson Labs. Actin-GFP mice were originally purchased from Jackson Labs but were generously donated by Dr. Ahmed Abdel-Latif at the University of Kentucky. All animals were housed in IVC cages with ad libitum access to food and water. All procedures were performed in accordance with the guidelines and protocols of the Office of Research Integrity and with approval of the Institutional Animal Care and Use Committee at the University of Kentucky. All procedures complied with ARRIVE (Animal Research: Reporting of In Vivo Experiments ) guidelines.

Bone marrow-derived macrophages (BMDMs) were extracted from the femur and tibia of cPLA2 KO and WT littermate controls as described previously . BMDMs were plated at cells in differentiation media containing Roswell Park Memorial Institute medium (RPMI, Thermo Fisher Scientific, #21870-092) supplemented with pen/strep (P/S, Thermo Fisher Scientific, #5140122), 1% HEPES (Sigma-Aldrich, #83264-100ML-F), 1% GlutaMAX 0.001 (Thermo Fisher Scientific, #35050061), 0.001% -mercaptoethanol (Thermo Fisher Scientific, #21985023), 10% FBS (Life Technologies, #10082147), and 20% supernatant from sL929 cells (a generous gift from Phillip Popovich, The Ohio State University). Supernatant collected from sL929 cells contains macrophage colony-stimulating factor, which helps to promote bone marrow cell differentiation into macrophages . After 7 days of differentiation, cells were transferred to 12 -well plates at a density of cells in RPMI containing GlutaMAX, and . On day 8, cells were stimulated for 24 h with LPS ( , Invivogen, #tlrl-eblps, standard preparation) and IFN- , eBioscience #14-831163) diluted in N2A growth medium (described below). At the time of stimulation, cells were also treated with myelin debris ( , preparation described below). Twenty-four hours after stimulation, the supernatants were removed and centrifuged at (Fischer Scientific AccuSpin Micro R centrifuge), and then this macrophage-conditioned medium (MCM) was either applied directly to immortalized neurons (N2A cells) to measure cytotoxicity or stored at prior to testing for nitric oxide content using the Griess Reagent KIT (Thermo Fisher Scientific # G-7921) and phenol red-free RPMI.

Moderate purity myelin ( myelin, with small contributions from the axolemma and other cellular membranes) was prepared as previously described . Brains were collected from C57BL/6 mice and stored at prior to myelin isolation. Brains were first rinsed and suspended in cold PBS with (PBS/P/S) and homogenized with the loose and tight pestles of a Dounce homogenizer (DWK Life Science, #357544). The resulting suspension was transferred to a 15 mL tube and pelleted at 447 g prior to discarding the supernatant. The pellet was resuspended in PBS/P/S, and then 5 mL of a 30% Percoll solution (Sigma-Aldrich, #P1644-500ML) was gently dispensed below the myelin solution to perform density-graded centrifugation. The layers were then centrifuged at 447 g for 15 min at under gentle acceleration/deceleration. This generated three distinct layers (soluble on top, myelin in middle, and Percoll/cell pellet on bottom). After removing the soluble fraction, the myelin was transferred to a fresh tube, resuspended in 10 mL of distilled water with , and incubated for 10 min at to induce hypoosmotic shock to further separate the membranes. The myelin was then repelleted at 447 g and suspended in PBS/P/S and Percoll to perform a second density gradient centrifugation as described above. The myelin was then suspended and pelleted twice in PBS/P/S to remove residual Percoll and watersoluble contaminants. Isolated myelin was then aliquoted and stored at . The final protein concentration of the myelin stock solutions produced by this protocol was with a standard deviation of mL as determined by a BCA Protein Assay Kit (Thermo Fisher Scientific #23225). With the application of myelin debris to BMDMs at , cells had a mean dosage of . Finally, to ensure that our results were not due to endotoxin contamination in our myelin preparations, we tested aliquots from each batch of myelin stimulant (Thermo Fisher Scientific #88282).

To assess the neurotoxicity of stimulated BMDMs, a mouse neuroblastoma cell line (Neuro-2a or N2A, a gift from Chris Richards, University of Kentucky) was maintained in N2A growth medium consisting of 45% DMEM, 45% OPTI-MEM reduced-serum medium, 10% fetal bovine serum (FBS), and 1% penicillin/ streptomycin. N2A cells were plated at a density of cells in 96-well tissue culture plates and allowed to proliferate for 48 h . The neurotoxicity of macrophage-conditioned media (MCM) was evaluated as reported previously using an MTT-based cell growth determination kit according to the manufacturer’s instructions (Sigma-Aldrich CGD1-1KT). Briefly, 24 h before testing, N2A growth media was replaced with serum-free N2A media to induce differentiation. On the day of testing, this medium was replaced by fresh MCM, and the N2A cells were incubated in MCM for 24 h before thiazolyl blue tetrazolium bromide (MTT ( ), per well) was added to each well, and the cells were further incubated for 2 h . The tetrazolium ring of MTT can be cleaved by mitochondrial dehydrogenases of viable cells, yielding purple formazan crystals, which were then dissolved in acidified isopropanol solvent. The resulting purple solution was spectro-photometrically measured at 570 nm in an Epoch microplate reader (BioTek Instruments, Inc., Winooski, VT) using 690 nm as
the background absorbance. These data are normalized to the nontoxic CTL values to generate a proportional decrease in viability values.

Macrophage reactive oxygen species (ROS) production was measured using chloromethyl -dichlorodihydrofluorescein diacetate (CM-H2DCFDA) (Invitrogen-gen #C6827) as previously described . In short, BMDMs were cultured and stimulated as described above except in a 96 -well plate ( cells ). Following the 24 -hour stimulation, the supernatants were removed and replaced with a solution of CMH2DCFDA in phenol red-free RPMI with GlutaMAX and penicillin/streptomycin and incubated at for 25 min . ROS mediate the conversion of this compound to fluorescent DCF, which was then detected by an Epoch microplate reader (BioTek Instruments, Inc., Winooski, VT) at the compound’s excitation/emission spectra of approximately 492-495/517-527 nm.

Macrophage arginase activity was measured using the Arginase Activity Assay Kit (ab180877). In short, BMDMs were cultured and stimulated as described above. Following the removal of the supernatant cells were washed 2 x in cold PBS, and homogenized in cold assay buffer on ice with a pipette. After following the manufacturer’s instructions, absorbances were read for samples and standards on a microplate reader at 570 nm on kinetic mode for 30 min at 37 degrees. In this assay, arginase reacts with arginine and forms intermediates that react and generate a colored product that can be measured at 570 nm . Using two timepoints in the linear range we converted optical densities into enzymatic activity using the formula provided by the manufacturer.

Macrophage nitric oxide production was measured using the Griess Reagent Kit (G-7921). In short, BMDMs were cultured and stimulated as described above except for a substitution using phenol red-free RPMI, and the stimulations were scaled down to a 96-well plate format ( cells ). Following the 24 -hour stimulation, the supernatants were removed and centrifuged at to remove cellular debris. Next, of Griess Reagent, of molecular grade water, and of sample supernatant were combined and incubated at room temp for 30 min . Final concentrations were then determined by reading sample absorbance at 548 nm in comparison with a standard curve.

To reduce the nonspecific effects of irradiation on the spinal cord, a preliminary dosing study was performed. Wild-type C57BL6 mice were exposed to a split dose of 8, 10.5, or 13 Gy of radiation from a Cesium-137 radioactive core. The two half doses were separated by 3 h . Hematopoietic stem cells (HSCs) were isolated from Actin-GFP donors, and were administered by retro-orbital injection into recipients one hour after the last dose of radiation. Mice were maintained on water supplemented with antibiotics ( 40 mg sulfamethoxazole trimethoprim per 100 ml water) (Bactrim) for one week prior to and 4 weeks after irradiation. Eight weeks after hematopoietic stem cell transplantation (HSCT), chimerization efficiency was determined by cytofluorometric analysis of circulating leukocytes. Whole blood was collected via cardiac puncture. Following the removal of erythrocytes by hyperosmotic lysis in ammonium chloride and Fc blocking (BD, 553142), leukocytes were stained with CD45-APC (BD Pharmingen, 559864), CD11b (Biolegend, 101235), and Ly6G (BD Biosciences, 560601). Stained blood samples were analyzed using a BD FACSymphony, and analysis was performed with FlowJo software. Additionally, the number of GFP + cells was assessed in coronal sections of the thoracic spinal cord. As described in the results, 10.5 Gys is the optimal dose that maximizes chimerization efficiency while minimizing leukocyte spinal cord infiltration. Therefore, a 10.5 Gy dose was utilized for subsequent HSCT studies. To generate cPLA2 KO chimeras, HSCT was performed as described above. cPLA2 KO and WT littermates were used as donors. Animals were injured weeks after HSCT. Chimerization efficiency was determined at study endpoints as described below via qRT-PCR.

As described previously , mice were anesthetized via intraperitoneal injection of ketamine ( ) and xylazine ( ). Following a T9 laminectomy, mice received a 65 kDyn T9 contusion SCI (Infinite Horizons Impactor) . Based upon a priori exclusion criteria, any mouse receiving SCI with abnormalities in the force vs. time curve generated by the IH device was considered to have received a “bad hit” and was excluded from analyses (see Table 1). Abnormalities meriting exclusion include bone hits or instability in the spinal cord at the time of injury. After injury the muscle incision was closed with an absorbable suture and the skin incision was closed using a monofilament suture. Mice received buprenorphine analgesic (Buprenex SR, ) and Baytril antibiotic (Enrofloxacin, ) subcutaneously once immediately after surgery as well as saline ( 1.0 mL ) and antibiotic ( ) subcutaneously for 5 days following surgery.

Locomotor recovery was assessed after SCI with the Basso Mouse Scale (BMS) open field test, CatWalk XT gait analysis system, and the horizontal ladder test. The BMS utilizes a 9-point rating scale to characterize gross locomotor functions ranging from complete paralysis (score 0 ) to normal functions (score 9 ) as mice explore an open field for . BMS scores were obtained at , and 42 dpi by two observers blinded to the treatment groups. Each hindlimb was scored separately based on movement (e.g., ankle placement and stepping), coordination, and trunk stability. Averaging both hindlimb scores generated a single score for each mouse. BMS subscores were derived from observations made during BMS scoring as described by Basso et al. .

BMS subscores are based on features of locomotion, such as trunk stability, coordination, and paw placement, that are observable in higher-functioning mice. BMS subscores permitted a better resolution to differentiate between mice with higher BMS scores.

We also used the CatWalk XT gait analysis system (Noldus, Wageningen, the Netherlands) to track specific parameters of gait. For CatWalk analysis, mice underwent three testing sessions: one week before injury and 4 – and 6 -weeks post-injury. The CatWalk features a red overhead light and green illuminated walkway, which reflects light in response to the contact of the mouse’s paw that is then captured via calibrated video recordings. Gait analysis was performed by the same researcher in a dark room. Using conditioning and analysis protocols developed previously , mice were allowed to acclimate in the room for 30 min prior to testing. For a single run, the mouse was first placed in the open end of the CatWalk under the red ceiling light and allowed to walk across the walkway. Each mouse completed three continuous runs on each analysis day, and a minimum of three valid runs, or complete walkway crossings, were obtained for each subject. Trials in which the mouse stopped, turned around, or significantly changed its speed during a run were excluded from analysis. Mice that did not complete three continuous runs after 25 attempts were excluded from analysis. Runs were analyzed by one researcher who was blinded to group assignments.

The horizontal ladder test was used to assess stepping and coordination at later stages of recovery according to previous studies . Mice were recorded from below with a high-resolution camera at 60 frames per second as they traversed 50 rungs of a metal ladder positioned horizontally. The ladder has 4 mm diameter rungs spaced 12 mm apart. A dark escape box was placed at the end of the 50th rung. An observer blinded to group inclusion watched the recordings and counted total hind paw slip events and total hind paw steps. Paw slips were counted when a hind paw fell below the rungs of the ladder at any point during a step cycle. Hind paw steps were counted any time a mouse restarted their step cycle. Paw slips were normalized to total steps taken by either hind paw and expressed as a percent. Three trials were quantified for each mouse, and the average of the 3 was used for the individual mouse. Trials were analyzed by one researcher who was blinded to group assignments.

At the study endpoint, mice were given a lethal dose of ketamine and xylazine. Blood was then collected by cardiac puncture in a heparinized needle and syringe and transferred to an EDTA-coated tube (VWR, 101094-004) for leukocyte isolation (see below). Mice were transcardially perfused with PBS followed by paraformaldehyde (PFA) in PBS (Millipore sigma). A 12 mm section of the spinal cord was collected that spanned the T9 lesion site. The spinal cord sections were postfixed in PFA for 2 h and washed overnight in 0.1 M PB . Spinal cords were dehydrated in sucrose for 1 week. Six millimeters of spinal cord tissue centered on the lesion site was blocked in optimal cutting temperature compound (OCT) (Sakura FineTek, USA, 4583). Each block contained 5 spinal cords ( randomly selected per group). Spinal cords were serially sectioned coronally at a thickness of in the coronal orientation. Tissue was collected on ColorFrost Plus Microscope Slides (Fisher Scientific). Ten sets of tissue were generated for each block that spanned the length of the lesion, and the distance between each section on a single slide was .

To assess lesion volume, all tissue was stained with eriochrome cyanine and neurofilament heavy, which stain intact myelin and axons, respectively. These markers were used to distinguish lesioned from intact tissue. To stain for neurofilament, sections underwent antigen retrieval in citrate buffer ( pH 6.0 ) at for 5 minutes. Sections were then treated with hydrogen peroxide in methanol and PBS to quench endogenous peroxidase activity. Next, sections were blocked in normal goat serum in PBS with Triton-X 100 for 1 hour. Sections were stained overnight at with neurofilament-200 kD (1:1,500: Ck x NF200; NFH; Aves Labs). Sections were washed in PBS followed by a 1 -hour incubation with biotinylated goat anti-chicken ( , BA9010, Vector Laboratories). Sections were then incubated in avidin-biotin complex solution (ABC; 1:200; PK6100; Vector Laboratories) and developed using 3,3′-diaminobenzidine (DAB). Sections were counterstained with eriochrome cyanine to visualize spared white matter. Stained slides were dehydrated using graded ethanol
dilutions, cleared using Histoclear (101412-878; VWR Scientific), and coverslipped using Permount (SP15500; Fisher Scientific). Slides were imaged using Axioscan (model Z1, Carl Zeiss AG., Oberkochen, GE) at 20x magnification and visualized and quantified using Halo software (Indica Labs, Albuquerque, NM).

At the study endpoint, peripheral blood was collected from all mice via cardiac puncture. Erythrocytes were removed using red blood cell (RBC) lysis buffer (BioLegend, 420301). Collected blood was mixed with RBC lysis buffer and left at room temperature for 5 min . Leukocytes were pelleted by centrifugation at 350 g for 5 min , and the lysis process was repeated twice. Leukocyte pellets were frozen on dry ice. RNA was isolated from leukocyte pellets using the RNeasy mini kit (Qiagen, 74104). RNA concentration was determined using a Nanodrop (Nanodrop Lite; Thermo Fisher Waltham, MA). cDNA libraries were made using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, 4368814). qRT-PCR was performed using SYBR green master mix and the following forward and reverse primers: (pla2g4a forward= “GATTCTGGAAATGTCTCTG GAAG”, reverse=”GGCTGACATTTTTCATTAGCTC”; GAPDH, forward=”CATCACTGCCACCCAGAAGA CTG “, reverse=”ATGCCAGTGAGCTTCCCGTTCAG “).

NanoString gene expression analysis was performed on whole spinal cord homogenate. Seven days after SCI, mice were transcardially perfused with PBS, and 6 mm of the spinal cord was removed and flash-frozen in liquid nitrogen. RNA was isolated from spinal cords using an RNeasy mini kit (Qiagen, 74104). RNA concentration was determined using a NanoDrop Lite (Thermo Fisher Waltham, MA), and samples were diluted to . RNA analysis was performed using Nanostring nCounter (nCounter SPRINT profiler; NanoString Technologies; Seattle, WA), available at the University of Kentucky’s Genomics Core Laboratory. The neuroinflammation code set was used to interrogate expression changes in genes associated with secondary injury processes that occur after SCI.

All statistical tests were performed using GraphPad Prism software (v9.4.1, Boston, MA). All in vitro data were analyzed using an ordinary one-way ANOVA followed by Tukey’s multiple comparisons test. An unpaired Student’s t test was used to compare cPLA2 expression between cPLA2 KO and WT chimeras. For behavioral data and histological analysis, a two-way repeated-measures ANOVA was used. Behavioral data were compared over time, and histological data were compared over distance from the epicenter. was considered significant.

In the context of SCI, bone marrow-derived macrophages (BMDMs) are bombarded by an array of stimuli that potentiate a proinflammatory phenotype . In addition, myelin debris is present at the injury site. Previously, we determined that BMDMs in vitro can be used to predict intraspinal macrophage responses . Here, we employed an in vitro model of BMDMs derived from cPLA2 KO and WT mice to investigate the role of cPLA2 in combined proinflammatory (LPS + IFN or M1) and myelin stimulation. No significant differences were noted between cPLA2 and WT cells under control conditions (M1 stimuli alone, Fig. 1). As we reported previously , BMDMs produced significantly more reactive oxygen species (ROS) and nitric acid when stimulated with M1 stimuli in combination with myelin than when stimulated with M1 stimuli alone (Fig. 1AB). This combinatorial effect of M1 + myelin on ROS and nitric acid production was significantly decreased in cPLA2-deficient macrophages compared to WT controls (Fig. 1A-B). Macrophage-mediated neurotoxicity was assessed by measuring the viability (MTT assay) of N2A neurons treated with macrophage-conditioned media (MCM) isolated from stimulated BMDMs. MCM from cPLA2-KO M1+myelin-stimulated macrophages was significantly less neurotoxic than that from WT controls stimulated with M1 + myelin (Fig. 1C). Additionally, neurotoxicity from MCM from macrophages treated with M1 + myelin did not reach significance compared to M1-stimulated macrophages (Fig. 1C). Arginase activity was unchanged in all groups regardless of cPLA2 genotype and treatment (Fig. 1D). Collectively, these data implicate cPLA2 in the myelin-mediated potentiation of proinflammatory and neurotoxic macrophage activation.

To test whether cPLA2 potentiated proinflammatory macrophage activation in vivo, we utilized a chimeric mouse model. We first performed a pilot experiment to optimize the radiation dose in our HSCT protocol. Our goal was to achieve robust bone marrow chimerization while minimizing immune cell infiltration into the intact CNS. Hematopoietic stem cells (HSCs) isolated from Actin-GFP mice were retro-orbitally injected into C57BL/6J mice after three different radiation doses ( , and 13 Gy ). Ten weeks after HSCT, leukocyte chimerization and spinal cord immune cell infiltration were assessed using flow cytometry and immunofluorescence microscopy, respectively. The proportion of GFP CD45 leukocytes and GFP CD45 CD11b Ly6 myeloid cells increased in a dose-dependent manner (Fig. 2A-F). Additionally, GFP cells in the spinal cord parenchyma also increased in a dose-dependent manner with the highest radiation dose ( 13 Gy ), producing noticeably more intraparenchymal GFP immune cells in the uninjured spinal cord compared to mice that received 10.5 Gys (Fig. 2G-I). In summary, the 10.5 Gy dose achieved approximately chimerization of circulating leukocytes (Fig. 2C) and Ly6G myeloid cells (Fig. 2F) with minimal spinal cord infiltration. Therefore, 10.5 Gy of radiation was used in subsequent chimera experiments.

Our optimized HSCT protocol enabled the interrogation of the role of cPLA2 in MDMs after SCI. WT C57BL6/J mice received HSCs from cPLA2 KO and WT littermate donors after 10.5 Gys. Eight to 12 weeks after HSCT, mice received a 65 kDyn T9 contusion SCI, and tissue was collected 7 days or 6 weeks after SCI (Fig. 3A-B). Whole blood was collected at the study endpoints, and cPLA2 expression was measured in isolated leukocytes. In all three cohorts, cPLA2 expression was decreased approximately tenfold in animals receiving KO vs. WT HSCs (Fig. 3B-C) (B, ; C, ). Additionally, the selective KO of cPLA2 in infiltrating MDM

was sufficient to significantly reduce overall cPLA2 expression in the spinal cord at 7 days, further confirming the effectiveness of our KO approach (Fig. 3D) ( ).

To test the hypothesis that MDM cPLA2 limits locomotor recovery after SCI, we assessed locomotor recovery of cPLA2 KO chimeras and WT chimera controls using the BMS score, BMS subscore, horizontal ladder, and CatWalkXT gait analysis system. BMS scoring and subscoring indicated recovery from complete paralysis with only some ankle movement (a score of 1 and 2 ) at 1 day postinjury (DPI) to frequent and consistent plantar stepping with coordinated stepping by 6 weeks postinjury (WPI) (a score of ). BMS subscoring allowed discrimination between higher-functioning animals and demonstrated significant locomotor recovery over the six-week observation period. Both the BMS scores and subscores observed at 4 WPI were consistent with previous studies in unirradiated mice that received a moderate SCI . Contrary to our hypothesis, neither BMS scoring nor subscoring indicated altered locomotor recovery in cPLA2 KO chimeras compared to WT chimera controls (Fig. 4A-B) (BMS scores, ; subscores, ). Since these mice were capable of weight-supported stepping, we performed horizontal ladder beam testing to assess hind limb recovery, as it is more sensitive to the recovery of stepping and coordination than BMS scoring alone . Horizontal ladder testing was performed only once at 6 WPI to limit adaptation and training to the test. Assessment of hindlimb function with horizontal ladder beam testing demonstrated no significant differences in locomotor recovery between cPLA2 KO and WT chimera controls (Fig. 4C) .

CatWalk gait analysis was performed before injury and 4 – and 6 -weeks post-injury. Using the CatWalk XT, we specifically assessed the regularity index, base of support, stride length, and print area as continuous measures sensitive to moderate and severe SCI. The regularity index, a measure of coordination, was significantly decreased after 4 weeks but increased to almost preinjury levels after 6 weeks, mirroring the increase in BMS score and subscore in the same time frame. cPLA2 KO chimeras did not have a significantly different regularity index compared to the WT control at any of the three-time points assessed (Fig. 4D) , ). The hind paw base of support measures the distance between hind paws during one step cycle and was decreased at both 4 and 6 WPI. It was not significantly different between groups at either time point (Fig. 4E) . Hind paw stride length measures the distance a single paw traverses between steps. Although hind paw stride length was relatively stable between 4 and 6 WPI, there was no significant difference between cPLA2 KO chimeras and WT controls (Fig. 4F) . Last, the hind paw print area measures the maximum paw print area during a placement event. The hind paw print area did not decrease after injury and was not different between groups at either timepoint (Fig. 4G) .

At the end of the 6 weeks, tissue was collected to assess the effect of cPLA2 KO chimerism on tissue pathology after SCI. Using eriochrome cyanine (EC) and neurofilament heavy (NF) staining, spared tissue was identified as double-positive (EC+, NF+) myelinated axons. Representative lesion epicenter images illustrate a clear contrast between areas of spared tissue and frank lesion areas in spinal cord tissue (Fig. 5A-B). Tissue sparing was not significantly different at the lesion epicenter or rostral and caudal to the epicenter between cPLA2 KO and WT chimeras (Fig. 5D-E) (5E, ). We also quantified intralesional axonal sprouting because other studies that manipulate MDMs in SCI have shown that intralesional axons are affected . We measured intralesional axon sprouting by quantifying the percent of total neurofilament-positive area in the lesion epicenter and at rostral and caudal to the epicenter (Fig. 5C). There was no difference in intralesionally spared axons between cPLA2 KO and WT chimeras in the sections assessed , ) (Fig. 5F).

The inflammatory microenvironment that persists chronically in the injured spinal cord limits recovery. The underlying mechanisms driving inflammation after SCI are poorly understood. Lipid-debris-laden macrophages that chronically linger in the injury site may be the culprit . Previous studies by our lab and others have

shown that myelin can induce a proinflammatory macrophage phenotype . Our previous work suggests that PLA2 enzymes are crucial for myelin-induced potentiation of a proinflammatory macrophage phenotype. In this study, we confirmed our previous in vitro work using cPLA2 KO macrophages in lieu of a nonspecific chemical inhibitor thus confirming that cPLA2 alone was sufficient to potentiate myelin-mediated proinflammatory activation. In vivo, cPLA2 KO chimeric mice had similar recovery and tissue sparing after SCI compared to WT chimera controls. Our findings suggest that cPLA2 does not have the same role in MDMs in vivo as it does in our in vitro model of the lipid-rich environment of SCI.
cPLA2 is widely studied in multiple diseases and is a key enzyme in arachidonic acid production . As such, cPLA2 has been a potential therapeutic target for SCI for almost two decades. Several studies have used pharmacologic and genetic techniques to inhibit cPLA2 with varied results. The earliest report by Huang et al. administered a single dose of cPLA2 inhibitor, after SCI and demonstrated improved locomotor recovery and neuronal survival during the first week .

Next, a comprehensive study of all PLA2s upregulated after SCI by Lòpez-Vales et al. reported reduced behavioral recovery and exacerbated tissue pathology after cPLA2 inhibition using a selective and potent 2 -oxoamide-based inhibitor and a cPLA2 global knockout mouse . This report also suggested that other PLA2s, such as secretory and calcium-independent phospholipases (sPLA2 and iPLA2), were pathological and that cPLA2 activity was beneficial. Work from the laboratory of Dr. Xiao-Ming Xu next reported that cPLA2 inhibition by continuous administration in rats and global genetic ablation in mice improved behavioral recovery and tissue sparing . In later studies, his group demonstrated that cPLA2 inhibition reduced RhoA/Rho kinase activity and vice versa . RhoA/Rho kinase activation is a major barrier to regeneration after SCI, as it leads to growth cone collapse and neurite retraction . Recently, his lab reported that cPLA2 inhibition decreases motor neuron loss and muscle atrophy after . Last, Li et al. reported that rescued dysfunctional autophagy after SCI . Overall, these reports, along with our data, suggest a complex role of cPLA2 in secondary injury and neuropathology after SCI.

In SCI, MDM cPLA2 may not contribute to secondary injury because most of the active cPLA2 is in neurons, astrocytes, and microglia. Early studies identified cPLA2-positive neurons in specific brain regions and spinal
cord motor neurons in uninjured rodent CNS with only faint signals in glia . Later studies reported the presence of cPLA2 immunoreactivity in rodent models of focal and global cerebral ischemia and amyotrophic lateral sclerosis, as well as brain tissue from Alzheimer’s disease . cPLA2 was present in regions of neuronal death but also in surrounding reactive astrocytes and microglia . In SCI, cPLA2 was thought to be expressed only in neurons, oligodendrocytes, and a subpopulation of microglia . Recently, more sensitive approaches to detect cPLA2 expression using RNA counting in sorted cells and single-cell transcriptomics have revealed cPLA2 expression in microglia, MDMs, and endothelial cells within the first week after injury . However, it is important to note that cPLA2 is activated by intracellular calcium and mitogen-activated protein kinasemediated phosphorylation; thus, antibody and nucleic acid-based detection are not sufficient to determine cPLA2 activity and concomitant arachidonic acid production . Thus, a cell-specific cPLA2 activity assay would determine the most likely target of cPLA2 inhibition after SCI. Alternatively, a “reverse chimera” could be generated in which WT bone marrow is transplanted into cPLA2 KO mice. These approaches would further clarify the role of MDM cPLA2 in secondary injury after SCI.

Alternatively, MDM cPLA2 may be detrimental to recovery, but the beneficial effect of MDM cPLA2 deletion could be overshadowed by deletion of cPLA2 in other HSC-derived cells, namely, platelets. cPLA2 inhibition in platelets with reduces the production of thromboxane A2, also called platelet-activating factor (PAF) . Additionally, cPLA2 null mice have decreased platelet aggregation and increased bleeding times . Our cPLA2 KO chimeras most likely had cPLA2-deficient platelets . cPLA2 KO platelets may have had limited efficacy in hemostasis acutely after SCI, leading to exacerbated hemorrhage. The extent of hemorrhage after SCI impacts recovery not only in rodents but also in humans. Hemorrhage measured by radiological imaging can predict outcomes in cases of SCI . Therefore, any beneficial effects of MDM cPLA2 KO may have been countered by exacerbated hemorrhage. Future experiments may be able to limit nonspecific cPLA2 inhibition through the use of Cre-mediated selective deletion from microglia and MDMs.

Our results demonstrate that cPLA2 in MDMs likely does not contribute significantly to macrophage-mediated pathology after SCI. We first showed that cPLA2 KO macrophages are protected from the proinflammatory potentiating effect of myelin. Using bone marrow chimeras, we then investigated the role of cPLA2 in MDMs after SCI. We found no effect of cPLA2 KO HSCT on locomotor recovery or tissue pathology. This discovery sheds light on a series of heterogeneous observations using global KO or suppression of cPLA2 in SCI.

All raw data presented in figures and tables herein is available to the public through the Open Data Commons for Spinal Cord Injury (ODC-SCI). The ODC-SCI is a dedicated data sharing portal and repository for the field of SCI that enables the sharing of data with the public using a DOI. The DOI associated with this work is as follows: http://dx.doi.org/10.34945/F52307. The ODC-SCI complies with the FAIR data principles to ensure that SCI data is Findable, Accessible, Interoperable and Reusable.

Received: 6 September 2024; Accepted: 30 December 2024
Published online: 02 January 2025

We would like to thank Dr. Xiao-Ming Xu for generously donating the cPLA2 KO mice. We would also like to thank Dr. Senthilnathan Palaniyandi and Dr. Josh Morganti for their technical assistance.

Conceptualization: E.G., T.K., J.G. Methodology: E.G., T.K., J.G. Validation: E.G. Formal Analyses: E.G.,T.K. Investigation: E.G., T.K., W.B., R.K., A.S., H.K. Data Curation: E.G. Writing: E.G. Reviewing and Editing: E.G., J.G., T.K. Project Administration: E.G., J.G. Funding Acquisition: E.G., T.K., & J.G. Supervision: J.G.

Funding support provided by: The Craig H. Neilsen Foundation under award #651996, the National Institute of Neurological Disorders and Stroke (NINDS) of the National Institutes of Health (NIH) under Awards: F31NS105443, F30NS129251 & R01NS116068.

The authors declare no competing interests.

Correspondence and requests for materials should be addressed to J.C.G.
Reprints and permissions information is available at www.nature.com/reprints.
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommo ns.org/licenses/by-nc-nd/4.0/.
© The Author(s) 2025