الميلاتونين الخارجي يعزز تحمل الإجهاد الناتج عن الملح والجفاف في الأرز من خلال تعزيز نمو النبات ونظام الدفاع Exogenous melatonin induces salt and drought stress tolerance in rice by promoting plant growth and defense system

المجلة: Scientific Reports، المجلد: 14، العدد: 1
DOI: https://doi.org/10.1038/s41598-024-51369-0
PMID: https://pubmed.ncbi.nlm.nih.gov/38216610
تاريخ النشر: 2024-01-12

الميلاتونين الخارجي يعزز تحمل الإجهاد الناتج عن الملح والجفاف في الأرز من خلال تعزيز نمو النبات ونظام الدفاع

ذاكر الله خان رحمة الله جان سليم عاصف محمد فاروق يون-هي جانغ يون-غيونغ كيم ناري كيم وكيوغ-مين كيم

نظرًا للتغير المناخي العالمي، تواجه المحاصيل بالتأكيد العديد من عوامل الضغط غير الحيوية والحيوية خلال نموها، مما يشكل تهديدًا خطيرًا لتطورها وإنتاجيتها العامة. من بين الضغوط غير الحيوية المختلفة، تعتبر الملح والجفاف من أكثر العوامل المدمرة التي تؤثر بشكل خطير على استقرار محصول المحاصيل. هنا، تهدف الدراسة الحالية إلى توضيح كيفية عمل الميلاتونين في تنظيم الكتلة الحيوية للنبات، والضغط التأكسدي، ونظام الدفاع المضاد للأكسدة، بالإضافة إلى التعبير عن الجينات المتعلقة بضغط الملح والجفاف في نباتات الأرز. خضعت ثماني مجموعات من نباتات الأرز (3 تكرارات، 5 نباتات لكل منها) لعلاجات متنوعة: التحكم، الميلاتونين، الملح، الجفاف، الملح + الجفاف، الملح + الميلاتونين، الجفاف + الميلاتونين، والملح + الجفاف + الميلاتونين. الميلاتونين (100 تم تطبيق ( ) بالتناوب قبل أسبوع من التعرض للإجهاد؛ حيث تم تطبيق إجهاد الملح بتركيز 100 مليمول من NaCl كل 3 أيام لمدة 3 أسابيع، وكان إجهاد الجفاف يتضمن تم أخذ عينات عشوائية من الأوراق الصغيرة من كل مجموعة. أظهرت النتائج أن معالجة الميلاتونين تقلل بشكل ملحوظ من أضرار الإجهاد الناتج عن الملح والجفاف من خلال تعزيز طول الجذور والسوق، وزيادة الوزن الطازج والوزن الجاف، وزيادة محتوى الكلوروفيل، وكبح الإنتاج المفرط لمؤشرات الإجهاد التأكسدي. كما أن الإجهاد الناتج عن الملح والجفاف قلل بشكل كبير من توازن المياه، وأضر بغشاء الخلية من خلال تقليل محتوى المياه النسبي وزيادة تسرب الإلكتروليتات. ومع ذلك، أظهرت نباتات الأرز المعالجة بالميلاتونين محتويات مائية نسبية عالية وتسرب إلكتروليتات منخفض. تحت ظروف الإجهاد الناتج عن الملح والجفاف، زادت تطبيقات الميلاتونين الخارجية من مستوى التعبير عن الجينات المستجيبة للإجهاد الناتج عن الملح والجفاف مثل OsSOS وOsNHX وOsHSF وOsDREB في نباتات الأرز. مجتمعة، تكشف نتائجنا أن معالجة الميلاتونين تزيد بشكل ملحوظ من تحمل نباتات الأرز للملح والجفاف، من خلال زيادة الكتلة الحيوية للنبات، وكبح تراكم ROS، وزيادة كفاءة الدفاع عن مضادات الأكسدة، وزيادة التعبير عن الجينات المستجيبة للإجهاد الناتج عن الملح والجفاف.
الأرز (Oryza sativa) هو أحد الأغذية الأساسية الرئيسية ويُزرع على نطاق واسع في جميع أنحاء العالم، ويعتمد حوالي نصف سكان العالم على الأرز. مع تزايد عدد سكان العالم تدريجياً، فإن الطلب على إنتاج الأرز يتزايد أيضاً. من احتياجات السعرات الحرارية للسكان في العالم يتم توفيره من الأرز، وجنوب شرق آسيا يعتمد على أكثر من لإجمالي السعرات الحرارية المستهلكة من الأرز قد يكون للتغير المستمر والسريع في المناخ تأثيرات خطيرة على المحاصيل الزراعية في مناطق المناطق الاستوائية وشبه الاستوائية بحلول نهاية هذا القرن. تغير المناخ هو أحد المشاكل الرئيسية الملحوظة التي تغير نمط المناخ، مما يؤدي إلى الجفاف والأحداث الجوية المتطرفة. من بين الكوارث الطبيعية، يُعتبر الجفاف واحدًا من أخطر الكوارث في جميع أنحاء العالم، حيث يتسبب في تدمير كبير للنظم البيئية والزراعة والمجتمعات البشرية. .
العواقب الرئيسية لتغير المناخ هي الجفاف، الذي يشكل تهديدًا مأساويًا لمصادر المياه والمحاصيل الزراعية وإنتاج الغذاء، ويتسبب في الاضطرابات البيئية والمجاعة في العالم. تؤثر تغيرات المناخ والاحترار العالمي بشكل مكثف على الدورة الهيدرولوجية الإقليمية والعالمية مما يؤدي إلى تكرار أحداث الجفاف. الأرز (Oryza sativa) كمحصول زراعي في حقول الأرز الذي يتأثر بشكل كبير بالجفاف، ويُقدّر أن الجفاف أثر على إنتاج الأرز في العالم بنحو . في آسيا من
يأتي إجمالي إنتاج الأرز من المناطق المروية تقليديًا، التي تواجه مشكلة الجفاف ونقص المياه. .
في الوقت نفسه، تعتبر الملوحة عاملاً بيئيًا آخر يزداد بشكل متزايد في مناطق زراعة الأرز، بسبب التأثيرات المشتركة لارتفاع درجات الحرارة، والجفاف، وارتفاع مستوى سطح البحر، والممارسات الزراعية الضعيفة. . في الأراضي المروية، كان إجهاد الملح تهديدًا خطيرًا لزراعة الأرز، ومن المتوقع أن يكون أكثر من في المستقبل القريب، بينما يُقدّر أن يصل إلى بواسطة يقلل إجهاد الملح من معدل امتصاص ثاني أكسيد الكربون الصافي، ونمو الورقة، وتضخم خلايا الورقة، وتراكم المادة الجافة، والنمو النسبي. يهيمن على ضغط الملوحة الصوديوم وكلوريد مما يؤثر سلبًا على نمو الأرز وتطوره بسبب خلق إجهاد أيوني وأوسموزي وأكسيدي ارتفاع مستوى الملح في نبات الأرز يزيد من مستوى السمية، مما يؤدي إلى شيخوخة الأوراق المبكرة وفي النهاية يؤدي إلى انخفاض مساحة الأوراق التي تقوم بعملية التمثيل الضوئي. .
الميلاتونين (N-أسيتيل-5-ميثوكسي تريبتامين) هو هرمون بيولوجي شائع يلعب دورًا مهمًا في الوظائف البيولوجية. مثل الإيقاعات اليومية تعديل المناعة وتقليل الإجهاد التأكسدي . لذا خلال النصف القرن الماضي، حظيت باهتمام كبير بسبب خصائصها المضادة للشيخوخة أظهرت الدراسات الحديثة أن الميلاتونين موجود في عدد كبير من النباتات الوعائية. ، حيث تلعب دورًا مهمًا في الإنبات تكوين الجذور الجانبية، نمو النبات والدفاع ضد الضغوط الحيوية وغير الحيوية كونه منظم نمو، أظهر الميلاتونين إمكانيات كبيرة في تعزيز مقاومة النباتات للجفاف. لقد جذبت الميلاتونين الباحثين لوضع استراتيجية فعالة لتحفيز تحمل المحاصيل للجفاف والملوحة والمعادن الثقيلة ودرجات الحرارة العالية والمنخفضة ونقص العناصر الغذائية وأنواع مختلفة من الأمراض. يمكن أن يحفز الميلاتونين نظام مضادات الأكسدة في النباتات، ويساعد في تحسين عملية التمثيل الضوئي في النباتات، ويعزز توازن الأيونات وينظم أيض هرمونات النباتات في ظل ظروف الإجهاد الملحي. أظهر معالجة الأرز بالميلاتونين تحسينًا في تحمل الإجهاد الملحي من خلال زيادة الوزن الطازج والوزن الجاف للنبات وتقليل تلف الغشاء البلازمي. عزز الميلاتونين الخارجي أنشطة الكاتالاز (CAT) والبيروكسيداز (POD) وسوبر أكسيد ديسموتاز (SOD) وأسكوربات بيروكسيداز (APX) في الذرة (Zea mays) .
توجد معلومات محدودة جدًا بشأن التأثيرات المشتركة للملوحة وإجهاد الجفاف على نباتات الأرز، ومع ذلك تم دراسة إجهاد الملوحة وإجهاد الجفاف وتأثيراتهما على الأرز بشكل فردي. تظهر دراسة حديثة على القطن (Gossypium hirsutum) أن إجهاد الملوحة والجفاف المشترك يسببان انخفاضًا كبيرًا في نمو النبات ومحتوى الكلوروفيل وعملية التمثيل الضوئي في القطن. أدى الإجهاد المشترك إلى تقليل نشاط إنزيمات مضادات الأكسدة مما أدى في النهاية إلى انخفاض الأداء الفسيولوجي لنباتات عباد الشمس. تغير الملوحة والجفاف مسارات الإشارات الأسموزية والأيونية في محاصيل مختلفة. مسار حساسية الملح المفرطة (SOS) يلعب دورًا رئيسيًا في الحفاظ على توازن الأيونات الخلوية خلال ضغط الملوحة. . OsNHX1 ( المبادل) هو عامل نسخ ينظم و تركيز نباتات الأرز عند تعرضها لضغط NaCl و KCl لقد أظهر الإفراط في التعبير عن NHX1 في التبغ أنه يمنح تحمل الملح. تم تحديد العديد من عوامل النسخ مثل DREB (عوامل الربط للاستجابة للجفاف) وABRE (عنصر الاستجابة لحمض الأبسيسيك) وERF (عامل الاستجابة للإيثيلين) التي تلعب دورًا مهمًا في تنظيم النسخ تحت ضغط الجفاف. زيادة التعبير عن HSF2 (عامل النسخ الناتج عن الصدمة الحرارية) حسنت من تحمل الجفاف في مرحلة الشتلات في الأرابيدوبسيس. تشارك HSFA3 و HSFA1b في مسارات إشارة مختلفة لتعزيز تحمل النبات للإجهاد الناتج عن الجفاف، بينما يعتمد تعبير HSFA3 استجابةً للإجهاد الناتج عن الجفاف على تعبير DREB2A. .
افترضت دراستنا أن تحفيز الميلاتونين يعزز تحمل نبات الأرز للضغط الناتج عن الجفاف والملوحة بشكل فردي وكذلك عند دمجهما. الهدف من دراستنا هو تقييم دور الميلاتونين في نباتات الأرز استجابةً للضغط الناتج عن الجفاف والملوحة بشكل فردي وعند دمجهما. ركزنا على تأثيرات الميلاتونين على المعايير الشكلية، ومضادات الأكسدة، والتنظيم النسخي للجينات المستجيبة للملوحة والجفاف استجابةً للضغط الناتج عن الجفاف والملوحة المدمجة.

المواد والأساليب
المواد النباتية وظروف النمو

تم استخدام بذور صنف الأرز إيلمي (Oryza sativa L.) في هذه التجربة، المقدمة من مختبر تربية النباتات الجزيئية، جامعة كيونغبوك الوطنية، كوريا. تم تعقيم بذور الأرز بمبيدات الفطريات لمدة ليلة، تلتها غسلات ثلاث بماء مزدوج التقطير. ثم تم الاحتفاظ ببذور الأرز في الماء لمدة 4 أيام في حاضنة في ظروف مظلمة عند تغيير الماء بعد كل 24 ساعة كما تم الإبلاغ عنه سابقًا في المرجع. بعد إنباتها لمدة ثلاثة أيام، تم زراعة البذور في أصص بلاستيكية بسعة 1 لتر مملوءة بخليط تربة متخصص (دوبيانا بلس) يتكون من جوز الهند. )، طحلب الخث ( ) ، فيرمكوليت ( ماساتو الديوماتيت )، برا مش ( ) ، سماد ( ) ومرطب ( )، المقدمة من شركة نونغكيونغ المحدودة، كوريا، لتعزيز نموها. تم زراعة البذور لمدة ثلاثة أسابيع في الدفيئة لإجراء تجارب إضافية.

تصميم تجريبي

في هذه التجربة، شاركت مجموعة إجمالية من ثمانية مجموعات من نباتات الأرز. كان لكل من هذه المجموعات ثلاث تكرارات، وداخل كل تكرار، كان هناك خمسة نباتات. كانت المجموعات التجريبية تشمل نباتات التحكم (C)، نباتات معالجة بالميلاتونين (M)، نباتات معالجة بالملح (S)، نباتات معالجة بالجفاف (D)، نباتات معالجة بالملح + الجفاف (S + D)، نباتات معالجة بالملح + الميلاتونين. )، النباتات المعالجة بالميلاتونين في ظل الجفاف ( ) والملح + الجفاف + المعالجة بالميلاتونين تم تطبيق الماء على أساس يومي. قبل أسبوع واحد، تم معالجة النباتات المعرضة للملح وإجهاد الجفاف بـ من الميلاتونين في أيام بديلة كما هو موصوف في المرجع. ، وتمت المعاينة الأولية لدينا. بالنسبة لإجهاد الملح، تم معالجة النباتات بتركيز 100 مللي مول من NaCl كل ثلاثة أيام لمدة 3 أسابيع. لإجهاد الجفاف تم استخدام بولي إيثيلين جلايكول 6000 (PEG 6000؛ منتج من سيغما-ألدريتش، سيول، كوريا) وفقًا للطريقة المستخدمة في المرجع. شمل التجربة الاختيار العشوائي للأوراق الشابة المتوسعة بالكامل من كل مجموعة تجريبية.

تحليل المعلمات الشكلية والكتلة الحيوية

بعد 35 يومًا من نمو النبات، تم قياس طول الساق، طول الجذر، ارتفاع الساق، والوزن الطازج (FW) لنباتات الأرز. لتحديد الوزن الجاف (DW) للشتلات، تم تجفيف الجذور والسوق في فرن عند لمدة 30 دقيقة وتم الحفاظ على لمدة 48 ساعة للحصول على الوزن الجاف. تم وضع الأوراق الطازجة في طبق بتري مملوء بالماء المقطر وتم وضع أطباق بتري في بيئة مظلمة لمدة 4 ساعات، ثم تم تسجيل وزنها المتورم (TW)، بعد ذلك تم تجفيف الأوراق في الفرن للحصول على الوزن الجاف. أخيرًا، تم قياس محتوى الماء النسبي (RWC) باستخدام الصيغة: .

محتويات الكلوروفيل

تم قياس محتويات الكلوروفيل بعد أسبوع من التعرض للإجهاد باستخدام مقياس الكلوروفيل المحمول (SPAD 502، كونكا مينولتا، اليابان). تم اختيار الورقة الثانية الأخيرة الناضجة تمامًا لقياس الكلوروفيل وتم أخذ القراءة من قاعدة الورقة، ومن المنتصف، وقريبًا من طرف الورقة. تم قياس خمس أوراق من كل مجموعة معالجة لمحتويات الكلوروفيل وتم أخذ القيمة المتوسطة كقيمة SPAD كما ذُكر سابقًا. .

تسرب الإلكتروليت

لتحديد تسرب الإلكتروليت، تم قطع عينات من الأوراق الطازجة إلى 5 مم ووضعها في أنابيب اختبار تحتوي على 10 مل من الماء منزوع الأيونات. تم تغطية الأنابيب بأغطية بلاستيكية ووضعها في حمام مائي maintained at the constant temperature of تم قياس الموصلية الكهربائية الأولية (ECI) بعد ساعتين بواسطة مقياس الموصلية الكهربائية (CM-115، كيوتو إلكتronics، كيوتو، اليابان). ثم تم تعقيم العينات في الأوتوكلاف عند لمدة 20 دقيقة لتحرير جميع الإلكتروليتات وقتل الأنسجة. لقياس الموصلية الكهربائية النهائية (EC2)، تم تبريد العينات إلى تم اكتشاف تسرب الإلكتروليت (EL) باستخدام الصيغة: .

تحديد ومحتويات MDA

تم قياس المحتويات باستخدام الطريقة الموصوفة سابقًا باختصار، تم طحن 0.1 جرام من الأوراق الطازجة في النيتروجين السائل، واستخراجها في 5 مل من TCA وتم الطرد المركزي عند لمدة 15 دقيقة. تم أخذ 0.5 مل من السائل العلوي، يود البوتاسيوم ومخزن فوسفات البوتاسيوم تمت إضافة (10 مللي مولار) وتم قياس الامتصاص عند 390 نانومتر. باستخدام معامل الانقراض تم تقدير المحتوى والتعبير عنه كـ تم تحديد محتويات MDA كما هو موضح سابقًا في المرجع. باختصار، تم طحن أوراق النباتات الطازجة بوزن 0.1 جرام في 10 مل من TCA. وتم الطرد المركزي عند لمدة 10 دقائق عند تم أخذ السائل العلوي في 4 مل من TBA، وتم حضنه عند لمدة 25 دقيقة ثم تم تبريده عند تم قراءة السائل العلوي عند 532 و 600 نانومتر. تم قياس محتوى MDA كـ من FW.

تحديد الأنشطة المضادة للأكسدة

تم تحديد نشاط الكاتالاز بواسطة طريقة المرجع. باختصار، تم معالجة الإنزيمات الخام بـ 0.5 مل من 0.2 مليمول استخدام محلول فوسفات الصوديوم بتركيز 7 pH. تم تحديد نشاط الكاتلاز من خلال الانخفاض في الامتصاصية عند 240 نانومتر، تم تعريف وحدة CAT كميكرومولات من بيروكسيد الهيدروجين. تم تحليلها لكل دقيقة لكل ملليجرام من البروتين. تم تحديد محتويات الجلوتاثيون المختزل باستخدام بروتوكول المرجع. باختصار، تم طحن الأوراق الطازجة في النيتروجين السائل، تم إضافة حمض ثلاثي كلورو الأسيتيك وتم الطرد المركزي عند لمدة 13 دقيقة عند تم دمج السائل العلوي مع 3 مل من 150 مليمول (pH 7.4). ثم أضيف حمض النيترو بنزويك (75.3 ملغ من DTNB مذاب في 30 مل من محلول فوسفات الصوديوم 100 مم، pH 6.8) تلاه الحضانة لمدة 5 دقائق في عند 412 نانومتر، تم قياس امتصاص العينات، وبالرجوع إلى منحنى القياس القياسي، تم حساب تركيز الجلوتاثيون المختزل والتعبير عنه كـ ( تم إجراء جميع التجارب ثلاث مرات.

عزل RNA و qRT-PCR

لتحديد مستوى التعبير عن و جين، تم جمع أوراق الأرز من كل مجموعة بشكل عشوائي في وبعد 48 ساعة من تعرض النباتات للإجهاد. تم استخراج RNA باستخدام مجموعات RNeasy Plant Mini Kits (50) من Qiagen، وتم تخليق cDNA باستخدام مجموعات qPCRBIO، بينما تم إجراء qRT-PCR باستخدام مجموعات qPCRBIO SYBR Green. تسلسل البرايمر ورقم الوصول لكل جين موضح في الجدول. تم بدء التفاعل باستخدام سايبر أخضر حمض نووي نموذج، و كل بادئ. تم تحضين التفاعل في لمدة دقيقتين، تليها خمسة وثلاثون دورة عند لمدة 10 ثوانٍ، و و لمدة 10 و 40 ثانية، على التوالي. تم إجراء كل تفاعل ثلاث مرات باستخدام الأكتين كجين مرجعي داخلي.
جين البرايمرات الأمامية البرايمرات العكسية رقم الانضمام
أوسأكتين CTGCGGGTATCCATGAGACT GGAGCAAGGCAGTGATCTTC X16280.1
OsHSF GCGAGAGAAGCTCAGCTAGG CCCAGACGTAGAATCCGGTG AK101182
OsDREB AGGAGGGAGAAATCTGGCAC CGCACTGAAAAGTGTGGACA AK062422
OsNHX GCGGTGCATTTTGCTCTCAA CCTGCTTCAGATCAGGGTGG AK104336
أوسوس TCGCAGACAGGGTGTTTGAT CGCTTTTGGGTGGAACACAC AK101368
الجدول 1. البرايمرات وأرقام الوصول للجينات المختارة التي صممتها NCBI لاختبار qRT-PCR.

التحليل الإحصائي

تم إجراء جميع التجارب ثلاث مرات. تم تحليل البيانات باستخدام تحليل التباين الثنائي مع اختبارات بونفيروني بعد الاختبار (*يظهر و يعرض فرق كبير). تم استخدام تصميم عشوائي كامل لمقارنة القيم المتوسطة للعلاجات المختلفة. تم تقديم البيانات بشكل رسومي، وتم حساب التحليلات الإحصائية باستخدام برنامج GraphPad Prism (الإصدار 5.01، GraphPad، سان دييغو، كاليفورنيا، الولايات المتحدة الأمريكية) ونظام التحليل الإحصائي (SAS 64 بت، الذي طورته جامعة ولاية كارولينا الشمالية، رالي، NC، الولايات المتحدة الأمريكية) (الشكل 1).

النتائج
نمو النبات تحت ضغط الملح/الجفاف وتأثيرات الميلاتونين

في هذه التجربة، قمنا بتقييم معايير نمو مختلفة لنباتات الأرز استجابةً للملوحة والجفاف معًا وكذلك الضغط الفردي كما هو موضح في (الشكل 2A). لقد أدى كل من ضغط الملوحة والجفاف إلى تقليل طول الساق للنبات بشكل كبير بـ في (S) في (D)، و في (S + D)، وطول الجذر بواسطة ، و مقارنة بـ (C). ومع ذلك، فإن النباتات المعالجة بالميلاتونين (M) أدت إلى زيادة في ارتفاع النبات مقارنة بـ إلى ، و إلى وزيادة في طول الجذر بـ إلى إلى ، و إلى ( ) على التوالي. بالإضافة إلى ذلك، فإن تطبيق الميلاتونين الخارجي زاد بشكل ملحوظ من طول ساق النبات بـ في ( ) ، في ( )، و في ( )، على التوالي. وبالمثل، أظهرت الميلاتونين زيادة في طول جذور النبات بـ في ( ) ، في ( )، و في ( ) مقارنةً بشروط الضغط الخاصة بهم (S)، (D)، و(S+D) (الشكل 2B). أدى الضغط الناتج عن الملح والجفاف إلى انخفاض كبير في وزن الساق الطازج ( ، و الوزن الجاف للساق ، و )، وزن الجذر الطازج ( ، و ) ووزن الجذور الجاف ( ، و ) في ( ) ، ( ) و ( ) عند المقارنة بـ ( ). النباتات التي تم معالجتها حصريًا بالميلاتونين (M) أظهرت زيادة في وزن الأجزاء الخضراء الطازجة ( ، و الوزن الجاف للساق ، و وزن الجذر الطازج ( ، و ) ووزن الجذور الجاف ( ، و بالمقارنة مع ، و . وبالمثل، أدى التطبيق الخارجي للميلاتونين إلى زيادة ملحوظة في كل من الوزن الطازج والوزن الجاف للساق والجذر. شهد الوزن الطازج للساق زيادات في في في ( )، و في ( )، في حين أظهرت وزن الجذر الطازج زيادات في في (S) في (D)، و في (S + D) مقارنةً بـ (S) و(D) و(S + D) (الشكل 2C). علاوة على ذلك، تم تعزيز الوزن الجاف للساق بواسطة في ( ) ، في ( )، و في ( )، بينما الجاف
الشكل 1. تصميم التجربة، موضحًا الصناديق التجريبية الثمانية وتطبيق الإجهاد الناتج عن الجفاف والملوحة. الصندوق (A) يظهر النباتات الضابطة. الصندوق (B) يظهر النباتات المعالجة بالميلاتونين فقط. الصندوق (C) يظهر النباتات المعرضة لإجهاد الملوحة. الصندوق (D) يظهر النباتات المعالجة بالميلاتونين والمعرضة لإجهاد الملوحة. الصندوق (E) يظهر النباتات المعرضة لإجهاد الجفاف. الصندوق (F) يظهر النباتات المعالجة بالميلاتونين والمعرضة لإجهاد الجفاف. الصندوق (G) يظهر النباتات المعرضة لإجهاد الملوحة والجفاف معًا. الصندوق (H) يظهر النباتات المعالجة بالميلاتونين والمعرضة لإجهاد الملوحة والجفاف معًا.
الشكل 2. تقييم معايير النمو في نباتات الأرز تحت ضغط الملح والجفاف. تظهر الأشكال أن الميلاتونين زاد من طول الجذور والسوق وكتلة النبات تحت ضغط الملح والجفاف بشكل فردي وكذلك بشكل مشترك. (أ) يظهر ضرر ضغط الملح والجفاف. (ب) طول الساق، (ج) طول الجذر، (د) الوزن الطازج والوزن الجاف. تم تحليل البيانات في ثلاث نسخ بيولوجية مستقلة. الانحراف المعياري (SD)، وتمت مقارنة المتوسطات باستخدام اختبارات دانييت. يشير إلى p و يشير إلى . حيث C هو التحكم، M هو الميلاتونين، S هو الملح، ( ) هو ملح + ميلاتونين، D هو جفاف، ( الجفاف + الميلاتونين، ) هو الملح + الجفاف و هو الملح + الجفاف + الميلاتونين.
وزن الجذر شهد زيادات من في ( ) ، في ( )، و في ( ) مقارنةً بـ (S) و (D) و (S+D) (الشكل 2D).

آثار الميلاتونين الخارجي على محتويات الكلوروفيل

أدى الإجهاد الناتج عن الملح والجفاف إلى انخفاض كبير في محتويات الكلوروفيل بـ ، و في (S)، (D)، و(S+D) مقارنةً بالتحكم (C). ومع ذلك، ، و تمت ملاحظة زيادة في النباتات المعالجة بالميلاتونين ( ) مقارنة بـ ( ) ، ( ) و ( ). وبالمثل، أدى علاج الميلاتونين إلى زيادة ملحوظة في محتويات الكلوروفيل، مع زيادات في في ( ) ، في ( )، و في ( ) مقارنة بـ ( S )، (D)، و ( ) الشروط ( الشكل 3A).

آثار الميلاتونين الخارجي على تسرب الإلكتروليتات

نفاذية الغشاء، كما يتضح من تسرب الإلكتروليت، تتأثر بشكل ملحوظ بكل من إجهاد الملح وإجهاد الجفاف بواسطة في (S) في (D)، و في (S+D) مقارنةً بـ (C). على الرغم من أن علاج الميلاتونين (M) قلل بشكل ملحوظ من تسرب الإلكتروليتات بواسطة ، و مقارنة بـ ( ) ، ( ) و ( )، على التوالي. علاوة على ذلك، فإن علاج الميلاتونين الخارجي قلل بشكل كبير من تسرب الإلكتروليتات بـ في في ( ) و في ( ) على التوالي مقارنةً بـ ( S ) و ( D ) و ( ) (الشكل 3B).

آثار الميلاتونين الخارجي على محتويات الماء النسبية

كنسبة لمستوى المياه في النبات، فإن محتوى المياه النسبي (RWC) لا يوفر فقط رؤى حول مستوى ترطيب النبات، بل يعمل أيضًا كمرآة لنشاطه الأيضي. ترتبط RWC ارتباطًا وثيقًا بالوظيفة الفسيولوجية للنباتات، كما تشير أيضًا إلى قدرة النبات على الحفاظ على محتوى الماء ودرجة ذبول الأوراق. خفض كبير في تحت ضغط الملح (S) تحت ضغط الجفاف (D)، و تحت
الشكل 3. تطبيق الميلاتونين يقلل من تأثيرات الإجهاد الناتج عن الملح والجفاف على محتويات الكلوروفيل. (A) يظهر قيم محتويات الكلوروفيل SPAD. (B) تسرب الإلكتروليت و (C) محتويات الماء النسبية التي يتم تنظيمها بواسطة العلاج الخارجي بالميلاتونين. تم تحليل البيانات في ثلاث تكرارات بيولوجية مستقلة. الانحراف المعياري (SD)، وتمت مقارنة المتوسطات باستخدام اختبارات دانييت. يشير إلى و يشير إلى .
إجهاد الملح والجفاف المدمج ) تم تسجيله مقارنةً بالتحكم ( C ). بينما كانت محتويات RLW و أعلى في النباتات المعالجة بالميلاتونين بالمقارنة مع ( ) ، ( ) و ( ). وبالمثل، أظهرت النباتات المعالجة بالميلاتونين زيادة ملحوظة في محتوى المياه النسبي، مسجلة ارتفاعًا قدره في ( ) ، في ( )، و في ( ) عند المقارنة مع ( S ) و ( D ) و ( ) الشروط ( الشكل 3C).

آثار الميلاتونين الخارجي على ومحتويات MDA

يعمل بيروكسيد الهيدروجين كمؤشر على قدرة النباتات على التخلص من أنواع الأكسجين التفاعلية (ROS) تحت ضغوط مختلفة، ويتم إنتاجه كناتج ثانوي لعملية الأيض الخلوي. تظهر النتائج أن أظهر زيادة كبيرة في تحت ضغط الملح (S) تحت ضغط الجفاف (D)، و تحت ضغط الملح والجفاف المشترك ) مقارنةً بالتحكم ( C ). أظهرت النباتات المعالجة بالميلاتونين ( M ) انخفاضًا في المحتويات بواسطة ، و مقارنة بالمستويات التي لوحظت في النباتات تحت ضغط الملح إجهاد الجفاف ، وإجهاد الملح والجفاف المدمج على التوالي. علاوة على ذلك، أظهرت تطبيقات الميلاتونين الخارجية انخفاضًا كبيرًا في تراكم، يظهر انخفاضات بنسبة في ( ) ، في ( )، و في ( ) مقارنة بـ ( S ) و ( D ) و ( ) (الشكل 4 أ).
أظهرت الضغوط الناتجة عن الملح والجفاف تأثيرًا ملحوظًا على محتويات المالونديالديهايد (MDA)، مما رفع المستويات بـ ، و في ظروف الإجهاد الناتج عن الملح (S) ، والإجهاد الناتج عن الجفاف (D) ، والإجهاد الناتج عن الملح والجفاف معًا ) النباتات، على التوالي، مقارنةً بالتحكم ( C ). في المقابل، أظهرت النباتات المعالجة بالميلاتونين ( M ) انخفاضًا كبيرًا في مستويات MDA بنسبة ، و مقارنة بالنباتات تحت معالجة الملح والميلاتونين )، الجفاف وعلاج الميلاتونين ( )، وعلاج الملح والجفاف والميلاatonin ( )، على التوالي. وبالمثل، تم تقليل محتويات MDA بشكل كبير بواسطة علاج الميلاتونين، حيث سجلت انخفاضات قدرها في ( ) ، في ( )، و في ( مقارنة بالنباتات تحت ضغط الملح (S) وضغط الجفاف (D) وظروف ضغط الملح والجفاف معًا (S+D) على التوالي (الشكل 4B).
الشكل 4. تطبيق الميلاتونين يخفف من إجهاد الملح والجفاف من خلال التخلص من تراكم الجذور الحرة. (A،B) يظهر ومحتويات MDA. كما ينظم الميلاتونين أنشطة مضادات الأكسدة. (C) يظهر أنشطة إنزيم الغلوتاثيون ريدوكتاز (GR) و(D) يظهر أنشطة الكاتالاز (CAT). تم تحليل البيانات في ثلاث نسخ بيولوجية مستقلة. الانحراف المعياري (SD)، وتمت مقارنة المتوسطات باستخدام اختبارات بونفيروني بعد التجربة. يشير إلى و يشير إلى .

الميلاتونين يقلل من الإجهاد التأكسدي من خلال تنظيم GR و CAT

يوفر الميلاتونين الحماية للنباتات من الضرر التأكسدي من خلال تنشيط مضادات الأكسدة. في هذه الدراسة، تم التحقيق في تأثيرات الإجهاد الناتج عن الملح والجفاف على أنشطة مضادات الأكسدة للجلوتاثيون (GSH) والكاتالاز (CAT) في نباتات الأرز، مع علاج الميلاتونين وبدونه. كشفت النتائج عن انخفاض كبير في الجلوتاثيون (GSH) بواسطة ، و في ظروف الإجهاد الناتج عن الملح (S) ، والإجهاد الناتج عن الجفاف (D) ، والإجهاد الناتج عن الملح والجفاف معًا ( ) النباتات مقارنةً بالتحكم ( C ). على النقيض، أظهرت النباتات المعالجة بالميلاتونين ( M ) زيادة في مستويات الجلوتاثيون (GSH) بمقدار ، و مقارنة بالنباتات التي تحت علاج الملح والميلاتونين )، الجفاف وعلاج الميلاتونين ( )، وعلاج الملح والجفاف والميلاatonin ( )، على التوالي. وبالمثل، زادت الميلاتونين من أنشطة الجلوتاثيون (GSH) بـ في ( ) ، في ( )، و في ( ) مقارنة بالنباتات تحت ضغط الملح ( S )، ضغط الجفاف ( D )، وضغط الملح والجفاف المشترك (S+D) (الشكل 4C).
أظهر نشاط الكاتالاز (CAT) زيادة تدريجية بسبب الإجهاد الناتج عن الملح والجفاف؛ ومع ذلك، فإن معالجة الميلاتونين سرعت من نشاطه. زاد نشاط الكاتالاز (CAT) بنسبة تحت ضغط الملح (S) تحت ضغط الجفاف (D)، و تحت ضغط الملح والجفاف المشترك (S+D) مقارنةً بالتحكم (C). كما تم تسجيل مستوى أعلى من الكاتالاز (CAT) بواسطة ، و في الملح والمعالجة بالميلاتونين )، الجفاف والمعالجة بالميلاتونين ( )، وملح مجمع، وجفاف، ومعالج بالميلاتونين ( ) الظروف مقارنة بالنباتات المعالجة بالميلاتونين (M). زادت معالجة الميلاتونين الخارجية بشكل كبير من نشاط الكاتالاز (CAT) بواسطة في (S) في (D)، و في (S+D) على التوالي (الشكل 4D).

الميلاتونين ينظم الجينات المستجيبة للإجهاد الناتج عن الملح والجفاف

تؤثر التأثيرات المشتركة للملوحة وإجهاد الجفاف بشكل كبير على تعبير الجينات المرتبطة بهذه الضغوط. تم ملاحظة تعبير OsSOS على أنه ، و تحت ضغط الملح (S)، و ، و تحت ضغط الملح والجفاف المشترك (S+D) بعد 6 و 24 و 48 ساعة من تطبيق الضغط، مقارنة بالنباتات الضابطة (C). بالإضافة إلى ذلك، أظهر OsSOS زيادة ملحوظة بـ
، و في (S+M)، و ، و في (S+D+M) بعد 6 و 24 و 48 ساعة، على التوالي، بعد تطبيق الإجهاد، مقارنة بالتعبير في النباتات المعالجة بالميلاتونين (M). أظهر الميلاتونين زيادة ملحوظة في تنظيم التعبير عن بواسطة ، و في ( ) بعد 6 و 24 و 48 ساعة من تطبيق الضغط. بالإضافة إلى ذلك، في (S+D+M)، زادت التعبير بـ ، و بعد 6 و 24 و 48 ساعة من تطبيق الضغط، على التوالي، عند مقارنتها بـ (S) و (S + D) (الشكل 5A). وبالمثل، أدى الضغط الناتج عن الملح والجفاف إلى تحفيز تعبير OsNHX بواسطة ، و في (S)، و ، ، و في S + D بعد 6 و 24 و 48 ساعة من الإجهاد، على التوالي، مقارنة بالنباتات الضابطة (C). أظهر OsNHX زيادة ملحوظة في ، و في (S+M)، و ، و في (S+D+M) بعد 6 و 24 و 48 ساعة، على التوالي، بعد التعرض للإجهاد، على عكس التعبير الذي لوحظ في النباتات المعالجة فقط بالميلاتونين (M). زاد الميلاتونين من تعبير OsNHX بـ ، و في (الملح + الميلاتونين) بعد 6 و 24 و 48 ساعة، و ، و في ( ) بعد 6 و 24 و 48 ساعة من تطبيق الضغط، على التوالي، مقارنة بـ (S) و (S+D) (الشكل 5B).
وبالمثل، فإن معالجة الميلاتونين الخارجي أدت أيضًا إلى تحفيز التعبير عن جينات الاستجابة للجفاف OsHSF و OsDREB. أظهر OsHSF زيادة ملحوظة في ، و في ظروف الجفاف (D)، و ، و في الملح والإجهاد الناتج عن الجفاف ) بعد 6 و 12 و 24 ساعة من الضغط، على التوالي، مقارنة بـ (C). أظهر OsHSF زيادة كبيرة في ، و في (S+M)، و ، و في ( ) بعد 6 و 24 و 48 ساعة، على التوالي، بعد التعرض للإجهاد، مقارنة بالتعبير الذي لوحظ في النباتات المعالجة فقط بالميلاتونين (M). زادت معالجة الميلاتونين من تعبير OsHSF بـ ، و في (D+M) بعد 6 و 24 و 48 ساعة و و في (S+D+M) بعد 6 و 24 و 48 ساعة من تطبيق الإجهاد على التوالي مقارنة بـ (D) و (S+D) (الشكل 5C). أدى إجهاد الملح والجفاف إلى زيادة كبيرة في تعبير OsDREB، مع زيادات من ، و في ظروف الجفاف (D)، و
الشكل 5. الميلاتونين يقلل من إجهاد الملح والجفاف من خلال تنظيم الجينات المستجيبة لإجهاد الجفاف والملح. أظهر التعبير النسبي لـ و جين الاستجابة للإجهاد الملحي بينما، (C، D) تظهر التعبير النسبي لـ و جينات الاستجابة للجفاف في نبات الأرز على التوالي. تم تحليل البيانات في ثلاث تكرارات بيولوجية مستقلة. الانحراف المعياري (SD)، وتمت مقارنة المتوسطات باستخدام اختبارات بونفيروني بعد الاختبار. يشير إلى و يشير إلى .
، و في الظروف الملحية والجفاف (S + D) بعد 6 و 12 و 24 ساعة من الإجهاد، مقارنةً بالتحكم (C). أظهر OsDREB زيادة ملحوظة في ، و في (S+M)، و ، و في ( ) بعد 6 و 24 و 48 ساعة، على التوالي، بعد التعرض للإجهاد، مقارنة بالتعبير الذي لوحظ في النباتات المعالجة فقط بالميلاتونين (M). وبالمثل، زاد الميلاتونين بشكل كبير من تعبير OsDRED بواسطة و في (D+M) بعد 6 و 24 و 48 ساعة و و في ( ) بعد 6 و 24 و 48 ساعة على التوالي مقارنة بـ (D) و (S+D) (الشكل 5D).

نقاش

في هذه الدراسة، أدى كل من الإجهاد الناتج عن الملح والجفاف، سواء بشكل مستقل أو معًا، إلى انخفاض كبير في نمو الأرز (الشكل 2). إن تثبيط نمو الأوراق الجديدة وتطور نظام الجذور بسبب الإجهاد الناتج عن الجفاف والملح هي عوامل معترف بها على نطاق واسع تسهم في تقليل تراكم الكتلة الحيوية. تؤدي ملوحة التربة وإجهاد الجفاف إلى تقليل معدلات إنبات البذور، وطول الساق والجذر، فضلاً عن الكتلة الحيوية الإجمالية لشتلات الأرز، مما يعيق نمو النبات. تؤكد هذه الدراسة أن كل من ملوحة التربة وإجهاد الجفاف قيدت بشدة نمو وتطور الأرز، كما هو موضح في (الشكل 2A،B). وقد أدت هذه الضغوط إلى تقليل كل من الوزن الطازج فوق الأرض والوزن الجاف بشكل كبير، كما هو موضح في (الشكل 2C،D). علاوة على ذلك، كان التأثير المثبط على نمو النبات والكتلة الحيوية أكثر وضوحًا تحت ضغط الملوحة مقارنة بإجهاد الجفاف. بالإضافة إلى ذلك، تلعب الكلوروفيل أدوارًا أساسية في نمو النبات وتطوره، وفي تخليق المنتجات الضوئية. يعيق ضغط الملوحة تخليق الكلوروفيل، مما يؤثر بشكل مباشر على عملية التمثيل الضوئي، ويؤخر نمو النبات، ويقلل من المحصول. . في هذه التجربة، خلال إجهاد الملح والجفاف، تم تقليل محتويات الكلوروفيل بشكل ملحوظ (الشكل 3A). قد يكون ذلك بسبب ارتفاع مستوى ، MDA، و م disrupting استقرار غشاء البلاستيدات الخضراء مما يؤدي إلى تدهور معقد البروتين-الصبغة-الدهون أدى التطبيق الخارجي للميلاتونين إلى عكس الاتجاه التنازلي وتعزيز نمو النبات وكتلة الحيوية ومحتويات الكلوروفيل (الشكل 3C، D). تتماشى هذه النتائج مع الأبحاث السابقة. مقترحًا أن التأثير المحتمل للميلاتونين على الإنزيمات يساهم في تعزيز مستوى الكلوروفيل ، مما يعزز نمو النباتات وتطورها.
تشير نتائج هذه الدراسة إلى أن مستويات الملح المرتفعة وإجهاد الجفاف أدت إلى انخفاض في محتوى الماء النسبي في الأوراق (RLWC). قد يكون هذا الانخفاض في RLWC قد ساهم في تقليل عوامل نمو النبات المختلفة. لقد عززت المعالجة السابقة بالميلاتونين بشكل ملحوظ محتوى الماء النسبي في الأوراق (RLWC) في نباتات الأرز تحت ظروف الإجهاد الناتج عن الملح والجفاف (الشكل 3C). هذه النتائج تتماشى مع النتائج السابقة من المرجع. يمكن أن يُعزى الارتفاع الملحوظ في RLWC إلى الدور المحتمل للميلاتونين في تعديل سلوك الثغور، مما ينظم بشكل فعال فتحها وإغلاقها لمنع فقدان الماء غير المبرر من الأوراق. تسرب الإلكتروليت (EL) يعمل كمؤشر على التغيرات في بنية غشاء الخلية خلال ظروف الملح العالي ونقص المياه. تظهر نتائجنا زيادة ملحوظة في تسرب الإلكتروليت خلال إجهاد الملح والجفاف (الشكل 3B). يسمح استخدام الموصلية النسبية بتقييم الضرر الذي يلحق بكل من بنية ووظيفة أغشية الخلايا تحت ضغوط مختلفة. أدى العلاج المسبق بالميلاتونين إلى تقليل تسرب الإلكتروليتات بشكل كبير خلال إجهاد الملح والجفاف في نباتات الأرز. تم الحصول على نتائج مماثلة من قبل المرجع. في الجفاف ومرجع. في ظروف الإجهاد الناتج عن الملح. وبالتالي، قد يكون الانخفاض في تسرب الإلكتروليتات مرتبطًا بارتفاع مستويات CAT (الكاتالاز) وGSH (الجلوتاثيون) نتيجة لعلاج الميلاتونين خلال ظروف الإجهاد الناتج عن الملح والجفاف. وهذا يشير إلى أن استخدام الميلاتونين قد يخفف من الضرر التأكسدي الناجم عن الإجهاد الناتج عن الملوحة والجفاف.
كلا من الإجهاد الناتج عن الملح والجفاف في نباتات الأرز يؤديان إلى إنتاج مفرط لجذور الأكسجين التفاعلية (ROS)، مما يؤدي بعد ذلك إلى تلف في مختلف الجزيئات الحيوية. هذه الاضطرابات في التوازن بين إنتاج وإزالة ROS تضيف إلى الإجهاد التأكسدي العام داخل نظام النبات. يُعتقد أن الميلاتونين يعمل كمضاد للأكسدة في النباتات، مما يساعد في تنظيم اختزال الخلايا، والتخلص من أنواع الأكسجين التفاعلية (ROS)، واستقرار أغشية خلايا النباتات، وبالتالي يوفر الحماية ضد مختلف الضغوط البيئية. . تظهر نتائجنا أن المعالجة المسبقة بالميلاتونين في الأرز قد خففت من تراكم أنواع الأكسجين التفاعلية (ROS) خلال الإجهاد الناتج عن الملح والجفاف (الشكل 4A،B). تتماشى هذه النتائج مع الملاحظات السابقة التي تشير إلى أن الميلاتونين يقلل من تراكم ROS في البطيخ والخيار المعرضين للإجهاد الملحي في الذرة وفول الصويا المعرضين للإجهاد الناتج عن الجفاف بالنسبة للنباتات غير المعالجة.
علاوة على ذلك، أفاد لي وآخرون أن تطبيق الميلاتونين الخارجي عزز من تحمل النباتات للبرد والجفاف والإجهاد الملحي. وقد تم عزو هذا التأثير إلى تقليل انفجار أنواع الأكسجين التفاعلية (ROS)، والحفاظ على كفاءة التمثيل الضوئي، وانخفاض مستويات المالونديالديهايد (MDA)، وتعزيز النشاط المضاد للأكسدة في نباتات الشاي. قد يكون للميلاتونين القدرة على تعزيز توازن الأكسدة والاختزال الخلوي من خلال تحفيز النظام المضاد للأكسدة بالكامل، بما في ذلك إنزيمات مضادات الأكسدة (مثل الكاتالاز، سوبر أكسيد ديسموتاز، بيروكسيداز، أسكوربات بيروكسيداز، ومونوهيدروأسكوربات ريدوكتاز) ومضادات الأكسدة غير الإنزيمية (مثل الجلوتاثيون والأسكوربات) ، بالإضافة إلى رفع مستويات البوليفينولات ، والكاروتينات ، والأنثوسيانين ، لحماية النباتات من الإجهاد الناتج عن العوامل غير الحيوية. ومع ذلك، لا تزال الآليات الدقيقة الكامنة وراء هذا التأثير التحفيزي غير واضحة. لم يتضح بعد ما إذا كان تأثير الميلاتونين ناتجًا عن تفاعل مباشر مع الإنزيمات الموجودة أو إذا كان ينطوي على آليات نقل الإشارة التي تنظم التعبير الجيني، مما يؤدي إلى زيادة إنتاج الإنزيمات.
في الظروف العادية، تقوم النباتات بتحييد أنواع الأكسجين التفاعلية (ROS) بفعالية من خلال كل من مضادات الأكسدة غير الإنزيمية والإنزيمية. ومع ذلك، تحت ظروف الملح والجفاف، يتجاوز إنتاج ROS قدرة أنظمة الدفاع المضادة للأكسدة، مما يؤدي إلى إجهاد أكسدي داخل النبات . الكاتالاز (CAT) والجلوتاثيون (GSH) هما مضادات أكسدة حيوية تشارك في عمليات حيوية داخل خلايا النبات. أثبتت العديد من الدراسات على النباتات ذات مستويات CAT وGSH المعدلة الأدوار المهمة لـ CAT وGSH في تحمل النباتات للإجهاد البيئي . تظهر نتائج دراستنا أن الإجهاد الناتج عن الملح والجفاف يزيد قليلاً من مستوى CAT كما هو موضح في (الشكل 4D). قد يكون هذا الارتفاع الطفيف في نشاط CAT ناتجًا عن تنشيطه لمواجهة تراكم الناتج عن نقص المياه وإجهاد الملوحة . تتماشى النتائج من هذه الدراسة مع الأبحاث السابقة التي تشير إلى أن النباتات تستجيب للتلف التأكسدي الناتج عن عوامل إجهاد مختلفة من خلال نشر
آليات للحفاظ على التوازن الخلوي وتحمل الإجهاد غير الحيوي . عندما تصبح مستويات الجلوتاثيون داخل الخلايا أكثر أكسدة أو تنخفض بسبب العوامل البيئية، فإنها تحفز عملية إشارة، مما يدفع الخلايا للتفاعل كما لو كانت مستويات الجلوتاثيون لديها منخفضة باستمرار، مما يساعد في تكيفها مع التغيرات في البيئة . يعتبر استقلاب الجلوتاثيون (GSH) والحفاظ على مخزون GSH جزءًا لا يتجزأ من استجابة النباتات لمختلف الضغوط غير الحيوية . سلطت العديد من الدراسات الضوء على انخفاض مستويات الجلوتاثيون (GSH) في أنواع نباتية مختلفة تحت ظروف الإجهاد مثل الملوحة، ودرجات الحرارة القصوى، والتعرض للمعادن الثقيلة . تشير نتائج الدراسة إلى انخفاض مستويات GSH خلال الإجهاد الناتج عن الملح والجفاف، كما هو موضح في (الشكل 4C). قد يُعزى هذا الاتجاه إلى تنشيط NADPH أوكسيداز، الذي له علاقة مباشرة مع كل من إنتاج ROS ومستويات GSH . ومع ذلك، فإن المعالجة الخارجية بالميلاتونين زادت بشكل كبير من نشاط CAT وGSH خلال الإجهاد الناتج عن الملح والجفاف (الشكل 4D). تتماشى النتائج التي تم الحصول عليها في هذه الدراسة مع النتائج السابقة. لقد عزز التطبيق الخارجي للميلا تونين بشكل كبير نشاط CAT في Zea mays L. وCynodon dactylon L. عند تعرضها للإجهاد الناتج عن الملوحة . بالإضافة إلى ذلك، أظهرت معالجة الميلاتونين أيضًا زيادة في نشاط CAT تحت ضغوط مركبة مختلفة مثل الملوحة والحرارة، والجفاف، وإجهاد البرد . في خلية النبات، يمكن تحويل الأنيون سوبر أكسيد ( ) بسرعة إلى بيروكسيد الهيدروجين ( ) بواسطة سوبر أكسيد ديسموتاز (SOD)، بينما يمكن أن يتم التخلص منه بواسطة الكاتالاز (CAT) ، ومشاركة الميلاتونين في تعزيز نشاط CAT تساهم في الحفاظ على توازن أنواع الأكسجين التفاعلية (ROS) داخل نظام النبات. وبالمثل، يلعب الميلاتونين دورًا كبيرًا في تعديل نشاط الجلوتاثيون (GSH) خلال ظروف الإجهاد غير الحيوية. يبدو أن تطبيق الميلاتونين يرفع مستويات الجلوتاثيون (GSH) في نباتات مختلفة بعد التعرض للملح ، والجفاف ، وإجهاد الحرارة . تتماشى نتائج دراستنا مع هذه النتائج، كما هو موضح في (الشكل 4C)، مما يبرز دور الميلاتونين في تعزيز نشاط GSH خلال ظروف الإجهاد. قد تشير مستويات GSH المرتفعة المنسوبة إلى الميلاتونين إلى دوره في تعديل دورة AsA-GSH، التي تلعب دورًا حيويًا في إزالة السموم من وتوفير الحماية للنباتات من الضغوط البيئية .
علاوة على ذلك، درسنا مستوى التعبير عن OsSOS وNHX وHSF وDREB تحت الإجهاد الناتج عن الملح والجفاف مع نقاط زمنية مختلفة استجابةً للميلا تونين. تم دراسة هذه الجينات بشكل موسع وتعتبر منظمين لاستجابة الإجهاد الناتج عن الجفاف والملح في نباتات الأرز. تؤثر تركيزات الملح المختلفة على التعبير الجيني في الأرز، مثل SOS2 وNHX التي تم التعبير عنها بشكل مفرط ونشطت مباشرة تعبير الناقلات، وتنظم تحمل الملح . تم تنظيم تعبير OsSOS1 وOsNHX1 في شتلات الأرز من خلال تطبيق 100 مليمول من . أظهر التعبير المفرط لـ تحت معالجة 150 مليمول من NaCl تحسينًا في معايير النمو والحفاظ على محتويات المياه النسبية . تلعب جينات OsNHX دورًا حيويًا في تنظيم تركيزات الصوديوم ( ) والبوتاسيوم ( ) داخل سيتوبلازم الأرز، مما يساعد في قدرة النبات على إدارة وتحمل إجهاد الملوحة . تظهر جينات عائلة OsNHX تنظيمًا في نباتات الأرز المعرضة للإجهاد الناتج عن الملوحة، ويمنح التعبير المفرط لـ OsNHX1 مقاومة لإجهاد الملوحة في الأرز المعدل وراثيًا . وفقًا لما ذكره كاتارين وآخرون ، الذين لاحظوا زيادة في تعبير OsNHX1 في أوراق شتلات الأرز Pokkali وIR29 تحت إجهاد ملوحة 200 مليمول، لاحظت دراستنا تنظيمًا مرتفعًا لـ OsSOS وOsNHX في النباتات المعرضة لكل من إجهاد الملح وإجهاد الملح والجفاف المركب (الشكل 5A،B). حسنت الميلاتونين الخارجية تحمل الملح من خلال تنظيم التعبير عن مسار SOS في Malus hupehensis وجينات SOS1 وSOS2 وSOS3 تحت إجهاد الملوحة في الأعشاب الطبية الصينية . أظهرت النباتات المعالجة بالميلاتونين التعبير المفرط لبروتينات نقل الأيون NHX1 و خلال التعرض لإجهاد الملح . تتماشى هذه الدراسة مع النتائج السابقة، حيث تؤكد أن التطبيق الخارجي للميلا تونين يساهم بشكل كبير في تخفيف إجهاد الملح من خلال تعديل التعبير عن جينات SOS وNHX (الشكل 5A،B). لقد أظهرت المعالجة المسبقة بالميلاتونين أنها تعزز نسخ OsSOS و في نباتات الأرز خلال إجهاد الملح، مما يساعد في إزالة والحفاظ على مقاومة النبات .
تظهر الدراسات أن عوامل النسخ المختلفة تم تحديدها والتي تلعب دورًا مهمًا في تنظيم استجابة النباتات لمختلف الضغوط . في صنف الأرز AP2، يتم تنظيم المحفزات النسخية OsDREB1A خلال الإجهاد الناتج عن الجفاف والملح العالي . تم تنظيم OsDREB1B وDREB1A في الأرابيدوبسيس لتعزيز الجفاف والملوحة العالية . تم الإبلاغ عن التعبير المفرط لجينات HSFA1 وHSFA2 في فول الصويا والطماطم والأرابيدوبسيس لتحسين مقاومة النباتات للحرارة . أظهرت دراسة حديثة أن OsHSFC1b يتم التعبير عنه بشكل مفرط لتحسين تحمل الملح في نباتات الأرز . علاوة على ذلك، أكد شارف وآخرون أن HSFA3 هو جزء من إشارة الإجهاد الناتج عن الجفاف. أظهرت نتائج دراستنا أن OsHSF وDREB يتم تنظيمهما في إجهاد الجفاف الفردي وإجهاد الجفاف والملح المركب (الشكل 5C،D)، مما يظهر أن OsHSF وDREB هما المنظمون النسخيون المهمون خلال إجهاد الجفاف في نباتات الأرز. عززت المعالجة الخارجية بالميلاتونين استقلاب الكربوهيدرات ونظمت عوامل النسخ مثل DREB وHSF وWRKY وMYB في نباتات مختلفة . ينظم الميلاتونين عوامل النسخ المختلفة مثل DREB في القطن , و DREB2A في الأرابيدوبسيس تحت ظروف الإجهاد الناتج عن الملوحة والجفاف . في دراستنا، أدى علاج الميلاتونين إلى زيادة كبيرة في تعبير جينات OsHSF و DREB في نباتات الأرز التي تعرضت للإجهاد الناتج عن الملوحة والجفاف بشكل فردي، وكذلك في ظروف الإجهاد المركب (الشكل 5C، D). لتلخيص ذلك، هناك فرضية تفيد بأن الميلاتونين يعزز استجابة نباتات الأرز للإجهاد الناتج عن الملوحة والجفاف. باختصار، يُفترض أن الميلاتونين يحسن استجابة نباتات الأرز للإجهاد الناتج عن الملوحة والجفاف. يتفاعل الميلاتونين مع إنتاج ROS داخل الخلايا. مع ارتفاع مستويات ROS، يعمل الميلاتونين كمضاد للأكسدة، حيث يقوم بإزالة هذه ROS وزيادة الأنشطة المضادة للأكسدة. يبدو أن الميلاتونين يحفز أو ينشط تعبير جينات المقاومة المحددة، مما يعزز قدرة النبات على تحمل الإجهاد الناتج عن الملوحة والجفاف. هناك حاجة إلى مزيد من التحقيق لفهم شامل للآليات ومسارات الإشارة المعنية في استجابة الميلاتونين تحت الإجهاد الناتج عن الملوحة والجفاف في نباتات الأرز.

الخاتمة

أظهرت دراستنا أن كل من الإجهاد الناتج عن الملوحة والجفاف تسبب في تلف أكسيدي من خلال توليد ROS وتلف الغشاء بسبب أكسدة الدهون، مما يؤدي إلى تقليل نمو وتطور نبات الأرز. يقلل تطبيق الميلاتونين الخارجي من الإجهاد الناتج عن الملوحة والجفاف بشكل فردي وكذلك في التركيب. زاد الميلاتونين من الوزن الطازج والوزن الجاف للأرز تحت الإجهاد الناتج عن الملوحة والجفاف. وبالمثل، قلل علاج الميلاتونين بشكل كبير من تراكم ROS وزاد من النشاط المضاد للأكسدة. علاوة على ذلك، زاد الميلاتونين من تعبير الجينات المسؤولة عن توازن الأيونات.
تتضمن الآفاق المستقبلية فك آليات الميلاتونين الدقيقة، وتحسين استراتيجيات تطبيقه، والتحقق من فعاليته في التجارب الميدانية لتحقيق مرونة المحاصيل المستدامة تحت ضغوط الملوحة والجفاف.

بيان الالتزام بدراسة إرشادات IUCN

تتوافق الدراسة الحالية مع الإرشادات ذات الصلة لبيان سياسة IUCN بشأن البحث المتعلق بالأنواع المعرضة لخطر الانقراض واتفاقية التجارة في الأنواع المهددة بالانقراض من الحيوانات والنباتات البرية.

توفر البيانات

البيانات المقدمة في هذه الدراسة متاحة عند الطلب من المؤلف المراسل.
تاريخ الاستلام: 17 أكتوبر 2023؛ تاريخ القبول: 4 يناير 2024
نُشر على الإنترنت: 12 يناير 2024

References

  1. Sen, S., Chakraborty, R. & Kalita, P. Rice-not just a staple food: A comprehensive review on its phytochemicals and therapeutic potential. Trends Food Sci. Technol. 97, 265-285 (2020).
  2. Fan, X. et al. Effects of high temperature on the fine structure of starch during the grain-filling stages in rice: Mathematical modeling and integrated enzymatic analysis. J. Sci. Food Agric. 99, 2865-2873 (2019).
  3. Fitzgerald, M. A., McCouch, S. R. & Hall, R. D. Not just a grain of rice: The quest for quality. Trends Plant Sci. 14, 133-139 (2009).
  4. Battisti, D. S. & Naylor, R. L. Historical warnings of future food insecurity with unprecedented seasonal heat. Science 323, 240-244 (2009).
  5. Nam, W.-H., Hayes, M. J., Svoboda, M. D., Tadesse, T. & Wilhite, D. A. Drought hazard assessment in the context of climate change for South Korea. Agric. Water Manag. 160, 106-117 (2015).
  6. Cook, B. I., Mankin, J. S. & Anchukaitis, K. Climate change and drought: From past to future. Curr. Clim. Change Rep. 4, 164-179 (2018).
  7. Sheffield, J. & Wood, E. F. Drought: Past Problems and Future Scenarios (Routledge, 2012).
  8. Allen, R. G. Crop evapotranspiration-Guideline for computing crop water requirements. Irrig. Drain 56, 300 (1998).
  9. Mostajeran, A. & Rahimi-Eichi, V. Effects of drought stress on growth and yield of rice (Oryza sativa L.) cultivars and accumulation of proline and soluble sugars in sheath and blades of their different ages leaves. Agric. Environ. Sci. 5, 264-272 (2009).
  10. Pandey, S., Bhandari, H. S. & Hardy, B. Economic Costs of Drought and Rice Farmers’ Coping Mechanisms: A Cross-Country Comparative Analysis (International Rice Research Institute, 2007).
  11. Thitisaksakul, M. et al. Effects of timing and severity of salinity stress on rice (Oryza sativa L.) yield, grain composition, and starch functionality. J. Agric. Food Chem. 68, 2296-2304 (2015).
  12. Hussain, S. et al. Effects of salt stress on rice growth, development characteristics, and the regulating ways: A review. J. Integr. Agric. 16, 2357-2374 (2017).
  13. Hussain, S. et al. Effects of 1-methylcyclopropene on rice growth characteristics and superior and inferior spikelet development under salt stress. J. Plant Growth Regul. 37, 1368-1384 (2018).
  14. Tarakcioglu, C. & Inal, A. Changes induced by salinity, demarcating specific ion ratio ( ) and osmolality in ion and proline accumulation, nitrate reductase activity, and growth performance of lettuce. J. Plant Nutr. 25, 27-41 (2002).
  15. Gunes, A. et al. Salicylic acid induced changes on some physiological parameters symptomatic for oxidative stress and mineral nutrition in maize (Zea mays L.) grown under salinity. J. Plant Physiol. 164, 728-736 (2007).
  16. Munns, R. Comparative physiology of salt and water stress. Plant Cell Environ. 25, 239-250 (2002).
  17. Shereen, A., Mumtaz, S., Raza, S., Khan, M. & Solangi, S. Salinity effects on seedling growth and yield components of different inbred rice lines. Pak. J. Bot. 37, 131-139 (2005).
  18. Reiter, R. J., Tan, D. X. & Galano, A. Melatonin: Exceeding expectations. Physiology 29, 325 (2014).
  19. Hardeland, R., Madrid, J. A., Tan, D. X. & Reiter, R. J. Melatonin, the circadian multioscillator system and health: The need for detailed analyses of peripheral melatonin signaling. J. Pineal Res. 52, 139-166 (2012).
  20. Calvo, J. R., Gonzalez-Yanes, C. & Maldonado, M. The role of melatonin in the cells of the innate immunity: A review. J. Pineal Res. 55, 103-120 (2013).
  21. Hardeland, R., Reiter, R., Poeggeler, B. & Tan, D.-X. The significance of the metabolism of the neurohormone melatonin: Antioxidative protection and formation of bioactive substances. Neurosci. Biobehav. Rev. 17, 347-357 (1993).
  22. Dubbels, R. et al. Melatonin in edible plants identified by radioimmunoassay and by high performance liquid chromatographymass spectrometry. J. Pineal Res. 18, 28-31 (1995).
  23. Zhang, N. et al. Melatonin promotes water-stress tolerance, lateral root formation, and seed germination in cucumber (Cucumis sativus L.). J. Pineal Res. 54, 15-23 (2013).
  24. Bajwa, V. S., Shukla, M. R., Sherif, S. M., Murch, S. J. & Saxena, P. K. Role of melatonin in alleviating cold stress in Arabidopsis thaliana. J. Pineal Res. 56, 238-245 (2014).
  25. Sharma, A. & Zheng, B. Melatonin mediated regulation of drought stress: Physiological and molecular aspects. Plants 8, 190 (2019).
  26. Tiwari, R. K. et al. Mechanistic insights on melatonin-mediated drought stress mitigation in plants. Physiol. Plant. 172, 1212-1226 (2021).
  27. Arnao, M. B. & Hernández-Ruiz, J. Melatonin: Plant growth regulator and/or biostimulator during stress? Trends Plant Sci. 19, 789-797 (2014).
  28. Yan, F. et al. Melatonin regulates antioxidant strategy in response to continuous salt stress in rice seedlings. Plant Physiol. 165, 239-250 (2021).
  29. Alharby, H. F. & Fahad, S. Melatonin application enhances biochar efficiency for drought tolerance in maize varieties: Modifications in physio-biochemical machinery. Agron. J. 112, 2826-2847 (2020).
  30. Ibrahim, W. et al. Comparative physiological analysis in the tolerance to salinity and drought individual and combination in two cotton genotypes with contrasting salt tolerance. Physiol. Plant. 165, 155-168 (2019).
  31. Anwar, K., Joshi, R., Dhankher, O. P., Singla-Pareek, S. L. & Pareek, A. Elucidating the response of crop plants towards individual, combined and sequentially occurring abiotic stresses. Int. J. Mol. Sci. 22, 6119 (2021).
  32. Kumar, G., Basu, S., Singla-Pareek, S. L. & Pareek, A. Unraveling the contribution of OsSOS2 in conferring salinity and drought tolerance in a high-yielding rice. Physiol. Plant. 174, e13638 (2022).
  33. Fukuda, A. et al. Function, intracellular localization and the importance in salt tolerance of a vacuolar antiporter from rice. Plant Cell Physiol. 45, 146-159 (2004).
  34. Lü, S. Y. et al. Antiporter gene from Hordum brevisubulatum (Trin.) link and its overexpression in transgenic tobaccos. J. Integr. Plant Biol. 47, 343-349 (2005).
  35. Singh, D. & Laxmi, A. Transcriptional regulation of drought response: A tortuous network of transcriptional factors. Front. Plant Sci. 6, 895 (2015).
  36. Joshi, R. et al. Transcription factors and plants response to drought stress: Current understanding and future directions. Front. Plant Sci. 7, 1029 (2016).
  37. Mao, X. et al. TaNAC2, a NAC-type wheat transcription factor conferring enhanced multiple abiotic stress tolerances in Arabidopsis. J. Exp. Bot. 63, 2933-2946 (2012).
  38. Scharf, K.-D., Berberich, T., Ebersberger, I. & Nover, L. The plant heat stress transcription factor (Hsf) family: Structure, function and evolution. Biochim. Biophys. Acta Gene Regul. Mech. 1819, 104-119 (2012).
  39. Jan, R., Khan, M. A., Asaf, S., Lee, I.-J. & Kim, K.-M. Overexpression of OsF 3 H modulates WBPH stress by alteration of phenylpropanoid pathway at a transcriptomic and metabolomic level in Oryza sativa. Sci. Rep. 10, 14685 (2020).
  40. Ahmad, S. et al. Exogenous melatonin confers drought stress by promoting plant growth, photosynthetic capacity and antioxidant defense system of maize seedlings. PeerJ 7, e7793 (2019).
  41. Schmidt, R. et al. SALT-RESPONSIVE ERF1 regulates reactive oxygen species-dependent signaling during the initial response to salt stress in rice. Plant Cell 25, 2115-2131 (2013).
  42. Jan, R. et al. Drought and UV radiation stress tolerance in rice is improved by overaccumulation of non-enzymatic antioxidant flavonoids. Antioxidants 11, 917 (2022).
  43. Bastam, N., Baninasab, B. & Ghobadi, C. Improving salt tolerance by exogenous application of salicylic acid in seedlings of pistachio. Plant Growth Regul. 69, 275-284 (2013).
  44. Khan, M. A. et al. Halotolerant rhizobacterial strains mitigate the adverse effects of NaCl stress in soybean seedlings. BioMed Res. Int. 2019, 1 (2019).
  45. Velikova, V., Yordanov, I. & Edreva, A. Oxidative stress and some antioxidant systems in acid rain-treated bean plants: Protective role of exogenous polyamines. Plant Sci. 151, 59-66 (2000).
  46. Khan, M. A. et al. Halo-tolerant rhizospheric Arthrobacter woluwensis AK1 mitigates salt stress and induces physio-hormonal changes and expression of GmST1 and GmLAX3 in soybean. Symbiosis 77, 9-21 (2019).
  47. Johansson, L. H. & Borg, L. H. A spectrophotometric method for determination of catalase activity in small tissue samples. Arch. Biochem. 174, 331-336 (1988).
  48. Ellman, G. L. Tissue sulfhydryl groups. Arch. Biochem. 82, 70-77 (1959).
  49. Huang, C. et al. Alteration in chlorophyll fluorescence, lipid peroxidation and antioxidant enzymes activities in hybrid ramie (Boehmeria nivea L.) Under drought stress. Austral. J. Crop Sci. 7, 594-599 (2013).
  50. Yang, S. & Deng, X. Effects of drought stress on antioxidant enzymes in seedlings of different wheat genotypes. Pak. J. Bot. 47, 49-56 (2015).
  51. Xiaoqin, Y., Jianzhou, C. & Guangyin, W. Effects of drought stress and selenium supply on growth and physiological characteristics of wheat seedlings. Acta Physiol. Plant. 31, 1031-1036 (2009).
  52. Khan, M. A., Gemenet, D. C. & Villordon, A. Root system architecture and abiotic stress tolerance: Current knowledge in root and tuber crops. Front. Plant Sci. 7, 1584 (2016).
  53. Luo, C. et al. Melatonin enhances drought tolerance in rice seedlings by modulating antioxidant systems, osmoregulation, and corresponding gene expression. Int. J. Mol. Sci. 23, 12075 (2022).
  54. Talubaghi, M. J., Daliri, M. S., Mazloum, P., Rameeh, V. & Mousavi, A. Effect of salt stress on growth, physiological and biochemical parameters and activities of antioxidative enzymes of rice cultivars. Cereal Res. Commun. 51, 403-411 (2023).
  55. Shahid, M. A. et al. Insights into the physiological and biochemical impacts of salt stress on plant growth and development. Agron. J. 10, 938 (2020).
  56. Mushtaq, Z. et al. Changes in growth, photosynthetic pigments, cell viability, lipid peroxidation and antioxidant defense system in two varieties of chickpea (Cicer arietinum L.) subjected to salinity stress. Phyton 91, 149 (2022).
  57. Imran, M. et al. Exogenous melatonin induces drought stress tolerance by promoting plant growth and antioxidant defence system of soybean plants. AoB Plants 13, 026 (2021).
  58. Arnao, M. & Hernández-Ruiz, J. Protective effect of melatonin against chlorophyll degradation during the senescence of barley leaves. J. Pineal Res. 46, 58-63 (2009).
  59. Ghanbari, F. & Sayyari, M. Controlled drought stress affects the chilling-hardening capacity of tomato seedlings as indicated by changes in phenol metabolisms, antioxidant enzymes activity, osmolytes concentration and abscisic acid accumulation. Sci. Hortic. 229, 167-174 (2018).
  60. Turk, H. et al. The regulatory effect of melatonin on physiological, biochemical and molecular parameters in cold-stressed wheat seedlings. Plant Growth Regul. 74, 139-152 (2014).
  61. Xu, X. D., Sun, Y., Sun, B., Zhang, J. & Guo, X. Q. Effects of exogenous melatonin on active oxygen metabolism of cucumber seedlings under high temperature stress. J. Appl. Ecol. 21, 1295-1300 (2010).
  62. Jungklang, J., Saengnil, K. & Uthaibutra, J. Effects of water-deficit stress and paclobutrazol on growth, relative water content, electrolyte leakage, proline content and some antioxidant changes in Curcuma alismatifolia Gagnep. cv. Chiang Mai Pink. Saudi J. Biol. Sci. 24, 1505-1512 (2017).
  63. Cui, G. et al. Beneficial effects of melatonin in overcoming drought stress in wheat seedlings. Plant Physiol. Biochem. 118, 138-149 (2017).
  64. Altaf, M. et al. Exogenous melatonin enhances salt stress tolerance in tomato seedlings. Biol. Plant. 64, 604-615 (2020).
  65. Das, K. & Roychoudhury, A. Reactive oxygen species (ROS) and response of antioxidants as ROS-scavengers during environmental stress in plants. Front. Environ. Sci. 2, 53 (2014).
  66. Tan, D. et al. Chemical and physical properties and potential mechanisms: Melatonin as a broad spectrum antioxidant and free radical scavenger. Curr. Top. Med. Chem. 2, 181-197 (2002).
  67. Li, H. et al. Exogenous melatonin confers salt stress tolerance to watermelon by improving photosynthesis and redox homeostasis. Front. Plant Sci. 8, 295 (2017).
  68. Zhao, H. et al. Melatonin increases the chilling tolerance of chloroplast in cucumber seedlings by regulating photosynthetic electron flux and the ascorbate-glutathione cycle. Front. Plant Sci. 7, 1814 (2016).
  69. Li, J. et al. Alleviation of cold damage by exogenous application of melatonin in vegetatively propagated tea plant (Camellia sinensis (L.) O. Kuntze). Sci. Hortic. 238, 356-362 (2018).
  70. Tomás-Zapico, C. & Coto-Montes, A. A proposed mechanism to explain the stimulatory effect of melatonin on antioxidative enzymes. J. Pineal Res. 39, 99-104 (2005).
  71. Reiter, R. J. et al. Melatonin as an antioxidant: Biochemical mechanisms and pathophysiological implications in humans. Acta Biochim. Polon. 50, 1129-1146 (2003).
  72. Wu, S. et al. Drought stress tolerance mediated by zinc-induced antioxidative defense and osmotic adjustment in cotton (Gossypium hirsutum). Acta Physiol. Plant. 37, 1-9 (2015).
  73. Zhang, N. et al. Melatonin improved anthocyanin accumulation by regulating gene expressions and resulted in high reactive oxygen species scavenging capacity in cabbage. Front. Plant Sci. 7, 197 (2016).
  74. Morales, F., Abadía, A. & Abadba, J. Photoprotection, Photoinhibition, Gene Regulation, and Environment 65-85 (Springer, 2008).
  75. Ball, L. et al. Evidence for a direct link between glutathione biosynthesis and stress defense gene expression in Arabidopsis. Plant Cell 16, 2448-2462 (2004).
  76. Pan, Y., Wu, L. J. & Yu, Z. L. Effect of salt and drought stress on antioxidant enzymes activities and SOD isoenzymes of liquorice (Glycyrrhiza uralensis Fisch). Plant Growth Regul. 49, 157-165 (2006).
  77. Yildiztugay, E., Ozfidan-Konakci, C., Kucukoduk, M., Tekis, S. A. & Science, S. The impact of selenium application on enzymatic and non-enzymatic antioxidant systems in Zea mays roots treated with combined osmotic and heat stress. Arch. Agron. 63, 261-275 (2017).
  78. Schafer, F. Q. & Buettner, G. R. Redox environment of the cell as viewed through the redox state of the glutathione disulfide/ glutathione couple. Free Radic. Biol. Med. 30, 1191-1212 (2001).
  79. Zhang, W., Tian, Z., Pan, X., Zhao, X. & Wang, F. Oxidative stress and non-enzymatic antioxidants in leaves of three edible canna cultivars under drought stress. Hortic. Environ. Biotechnol. 54, 1-8 (2013).
  80. Tepe, M. & Harms, H. Influence of abiotic stress on the GSH/GSSG system of plant cell cultures. Mol. Biol. Plants 158, 75-78 (1995).
  81. Dash, S. & Mohanty, N. Response of seedlings to heat-stress in cultivars of wheat: Growth temperature-dependent differential modulation of photosystem 1 and 2 activity, and foliar antioxidant defense capacity. J. Plant Physiol. 159, 49-59 (2002).
  82. De Vos, C. R., Vonk, M. J., Vooijs, R. & Schat, H. Glutathione depletion due to copper-induced phytochelatin synthesis causes oxidative stress in Silene cucubalus. Plant Physiol. 98, 853-858 (1992).
  83. Liu, T., Sun, L., Zhang, Y., Wang, Y. & Zheng, J. Imbalanced GSH/ROS and sequential cell death. J. Biochem. Mol. Toxicol. 36, e22942 (2022).
  84. Chen, Y. E. et al. Exogenous melatonin enhances salt stress tolerance in maize seedlings by improving antioxidant and photosynthetic capacity. Physiol. Plant. 164, 349-363 (2018).
  85. Liang, D. et al. Melatonin improves heat tolerance in kiwifruit seedlings through promoting antioxidant enzymatic activity and glutathione S-transferase transcription. Molecules 23, 584 (2018).
  86. Huang, B. et al. Exogenous melatonin alleviates oxidative damages and protects photosystem II in maize seedlings under drought stress. Front. Plant Sci. 10, 677 (2019).
  87. Foyer, C. H. & Noctor, G. Ascorbate and glutathione: The heart of the redox hub. Plant Physiol. 155, 2-18 (2011).
  88. Wei, J. et al. Phytomelatonin receptor PMTR 1-mediated signaling regulates stomatal closure in Arabidopsis thaliana. J. Pineal Res. 65, e12500 (2018).
  89. Liu, C. et al. OsbZIP71, a bZIP transcription factor, confers salinity and drought tolerance in rice. Plant Mol. Biol. 84, 19-36 (2014).
  90. Wang, H. et al. Effects of salt stress on ion balance and nitrogen metabolism of old and young leaves in rice (Oryza sativa L.). BMC Plant Biol. 12, 1-11 (2012).
  91. Fukuda, A., Nakamura, A., Hara, N., Toki, S. & Tanaka, Y. Molecular and functional analyses of rice NHX-type Na+/H+ antiporter genes. Plant Physiol. 233, 175-188 (2011).
  92. Theerawitaya, C., Tisarum, R., Samphumphuang, T., Takabe, T. & Cha-Um, S. Expression levels of the Na+/K+ transporter OsHKT2; 1 and vacuolar exchanger OsNHX1, Na enrichment, maintaining the photosynthetic abilities and growth performances of Indica rice seedlings under salt stress. Physiol. Mol. Biol. Plants 26, 513-523 (2020).
  93. Li, C. et al. Melatonin mediates the regulation of ABA metabolism, free-radical scavenging, and stomatal behaviour in two Malus species under drought stress. J. Exp. Bot. 66, 669-680 (2015).
  94. Chen, G. et al. Melatonin in Chinese medicinal herbs. Life Sci. 73, 19-26 (2003).
  95. Yan, F. et al. Melatonin enhances homeostasis in rice seedlings under salt stress through increasing the root pump activity and transporters sensitivity to ROS/RNS. Environ. Exp. Bot. 182, 104328 (2021).
  96. Singh, K. B., Foley, R. C. & Oñate-Sánchez, L. Transcription factors in plant defense and stress responses. Curr. Opin. Plant Biol. 5, 430-436 (2002).
  97. Dubouzet, J. G. et al. OsDREB genes in rice, Oryza sativa L., encode transcription activators that function in drought-, high-salt-and cold-responsive gene expression. Plant J. 33, 751-763 (2003).
  98. Kasuga, M., Liu, Q., Miura, S., Yamaguchi-Shinozaki, K. & Shinozaki, K. Improving plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible transcription factor. Nat. Biotechnol. 17, 287-291 (1999).
  99. Liu, J.-G. et al. OsHSF7 gene in rice, Oryza sativa L., encodes a transcription factor that functions as a high temperature receptive and responsive factor. BMB Rep. 42, 16-21 (2009).
  100. Charng, Y.-Y. et al. A heat-inducible transcription factor, HsfA2, is required for extension of acquired thermotolerance in Arabidopsis. Plant Physiol. 143, 251-262 (2007).
  101. Han, G. et al. C2H2 zinc finger proteins: Master regulators of abiotic stress responses in plants. Front. Plant Sci. 11, 115 (2020).
  102. Shi, H., Chen, K., Wei, Y. & He, C. Fundamental issues of melatonin-mediated stress signaling in plants. Front. Plant Sci. 7, 1124 (2016).
  103. Zhang, L. et al. A cotton group C MAP kinase gene, GhMPK2, positively regulates salt and drought tolerance in tobacco. Plant Mol. Biol. 77, 17-31 (2011).

مساهمات المؤلفين

Z.K. و R.J. و K.-M.K.؛ صمموا الدراسة؛ Z.K. و R.J. و S.A. و M.-F.؛ أجروا التجارب؛ E.-G.K. و Y.H.J. و N.K.؛ ساهموا في التحليل الإحصائي؛ Z.K. و R.J. و K.-M.K.؛ كتبوا المخطوطة. قرأ جميع المؤلفين ووافقوا على النسخة المنشورة من المخطوطة.

التمويل

تم إجراء هذا العمل بدعم من “برنامج البحث التعاوني لتطوير علوم وتكنولوجيا الزراعة (رقم المشروع RS-2022-RD010034)” إدارة التنمية الريفية، جمهورية كوريا. كما تم توفير التمويل من قبل برنامج البحث التعاوني لتطوير علوم وتكنولوجيا الزراعة إدارة التنمية الريفية، جمهورية كوريا، رقم المشروع RS-2023-00217583.

المصالح المتنافسة

يعلن المؤلفون عدم وجود مصالح متنافسة.

معلومات إضافية

يجب توجيه المراسلات والطلبات للحصول على المواد إلى R.J. أو K.-M.K.
معلومات إعادة الطبع والتصاريح متاحة علىwww.nature.com/reprints.
ملاحظة الناشر تظل Springer Nature محايدة فيما يتعلق بالمطالبات القضائية في الخرائط المنشورة والانتماءات المؤسسية.
الوصول المفتوح هذه المقالة مرخصة بموجب رخصة المشاع الإبداعي للاستخدام والمشاركة والتكيف والتوزيع وإعادة الإنتاج في أي وسيلة أو تنسيق، طالما أنك تعطي الائتمان المناسب للمؤلفين الأصليين والمصدر، وتوفر رابطًا لرخصة المشاع الإبداعي، وتوضح ما إذا كانت هناك تغييرات قد أُجريت. الصور أو المواد الأخرى من طرف ثالث في هذه المقالة مشمولة في رخصة المشاع الإبداعي للمقالة، ما لم يُذكر خلاف ذلك في سطر ائتمان للمادة. إذا لم تكن المادة مشمولة في رخصة المشاع الإبداعي للمقالة وكان استخدامك المقصود غير مسموح به بموجب اللوائح القانونية أو يتجاوز الاستخدام المسموح به، ستحتاج إلى الحصول على إذن مباشرة من صاحب حقوق الطبع والنشر. لعرض نسخة من هذه الرخصة، قم بزيارةhttp://creativecommons.org/licenses/by/4.0/.
© المؤلفون 2024
  1. قسم علوم الأحياء التطبيقية، كلية الدراسات العليا، جامعة كيونغبوك الوطنية، دايجو 41566، كوريا الجنوبية. معهد أبحاث الزراعة الساحلية، جامعة كيونغبوك الوطنية، دايجو 41566، كوريا الجنوبية. البريد الإلكتروني:rehmatbot@yahoo.com; kkm@knu.ac.kr

Journal: Scientific Reports, Volume: 14, Issue: 1
DOI: https://doi.org/10.1038/s41598-024-51369-0
PMID: https://pubmed.ncbi.nlm.nih.gov/38216610
Publication Date: 2024-01-12

Exogenous melatonin induces salt and drought stress tolerance in rice by promoting plant growth and defense system

Zakirullah Khan , Rahmatullah Jan , Saleem Asif , Muhammad Farooq , Yoon-Hee Jang , Eun-Gyeong Kim , Nari Kim & Kyung-Min Kim

Due to global climate change, crops are certainly confronted with a lot of abiotic and biotic stress factors during their growth that cause a serious threat to their development and overall productivity. Among different abiotic stresses, salt and drought are considered the most devastating stressors with serious impact on crop’s yield stability. Here, the current study aimed to elucidate how melatonin works in regulating plant biomass, oxidative stress, antioxidant defense system, as well as the expression of genes related to salt and drought stress in rice plants. Eight groups of rice plants ( 3 replicates, 5 plants each) underwent varied treatments: control, melatonin, salt, drought, salt + drought, salt + melatonin, drought + melatonin, and salt + drought + melatonin. Melatonin (100 ) was alternately applied a week before stress exposure; salt stress received 100 mM NaCl every 3 days for 3 weeks, and drought stress involved PEG. Young leaves were randomly sampled from each group. The results showed that melatonin treatment markedly reduces salt and drought stress damage by promoting root, shoot length, fresh and dry weight, increasing chlorophyll contents, and inhibiting excessive production of oxidative stress markers. Salt and drought stress significantly decreased the water balance, and damaged cell membrane by reducing relative water contents and increasing electrolyte leakage. However, melatonin treated rice plants showed high relative water contents and low electrolyte leakage. Under salt and drought stress conditions, exogenous application of melatonin boosted the expression level of salt and drought stress responsive genes like OsSOS, OsNHX, OsHSF and OsDREB in rice plants. Taken together, our results reveal that melatonin treatment significantly increases salt and drought tolerance of rice plants, by increasing plant biomass, suppressing ROS accumulation, elevating antioxidants defense efficiency, and up-regulating the expression of salt and drought stress responsive genes.
Rice (Oryza sativa) is one of the major staple food and widely cultivated throughout the world, and about half of the world population is depends upon rice . As the population of world is increasing gradually, therefore the demand for the rice production is also increasing of the calorific needs to the population of the world is provided by rice and south east Asia depends upon more than for their calorific intake upon rice . Continuous and rapid change in the climate may have serious impacts on the agricultural crops in the tropics and subtropics region by the end of this century . Climate change is one of the major notable problem that alter the climate pattern, resulting droughts and extreme weather events . Among the natural disasters, drought is one of the most dangerous disaster throughout the World, causing a significant ruin to ecosystems, agriculture and human societies .
The major consequences of climate change are droughts which are tragic threat to water supplies, agriculture crops, food production and causing ecological disturbance and famine in the World . Climate change and global warming are intensively affecting the regional and Worldwide hydrological cycle leading to the frequency of drought events . Rice (Oryza sativa) as a paddy field agriculture crop which is significantly susceptible to droughts, and it is estimated that drought affected the World rice production nearly by . In Asia of
the total rice production comes from traditionally irrigated areas, which is facing the problem of droughts and water scarcity .
At the same time salinity is an another environmental factor increasing in magnitude in the rice growing areas, due to the combine effects of high temperature, drought, sea level rising, and inferior agriculture practices . In irrigated land, salt stress has been a serious threat to rice cultivation, and expected to be more than in the near future, while it is estimated to reach by . Salt stress reduce the rate of net carbon dioxide assimilation, growth of the leaf, enlargement of the leaf cell, accumulation of dry matter and relative growth . The stress of salinity is dominated by sodium and chloride , negatively affecting rice growth and development due to creating ionic, osmotic and oxidative stress . High level of salt in rice plant increase the toxicity level, leading to early leaf senescence and ultimately resulting the decrease in the photosynthetic leaf area .
Melatonin ( N -acetyl-5-methoxytryptamine) is common biological hormone that plays an important role in biological functions , like circadian rhythms , immunomodulation , and oxidative stress reduction . Hence during the past half century, it received great attention due to its anti-aging properties . Recent studies showed that melatonin is present in a large number of vascular plants , having an important role in germination , lateral root formation, plant growth and defense against biotic and abiotic stresses . Being a growth regulator, melatonin showed a great potential for enhancing plant drought resistance . Melatonin has attracted the researcher to have an effective strategy to induce the crop tolerance against drought, salt, heavy metals, high temperature, low temperature, nutritional deficiencies and different types of diseases . Melatonin can induce plant antioxidant system, help in plant photosynthesis improvement, enhance ion homeostasis and regulate plant hormone metabolism under the salt stress condition . Pretreatment of rice with melatonin showed improvement in tolerance to salt stress by increasing plant’s fresh and dry weight and minimize plasma membrane damage . Exogenous melatonin enhanced catalase (CAT), peroxidase (POD), superoxide dismutase (SOD) and ascorbate peroxidase (APX) activities in maize (Zea mays) .
There is very limited information regarding the combined effects of salt and drought stress on rice plants, however salt and drought stress and its effects on rice were studied individually. A recent study on cotton (Gossypium hirsutum) shows that salt and drought combine stress cause significant reduction in plant growth, chlorophyll content and photosynthesis in cotton . Combined stress reduced the activity of antioxidant enzymes which ultimately decreased the physiological performance of sunflower plants. Salinity and drought change the osmotic and ionic signal pathways in different crops Salt Overly Sensitive (SOS) pathway plays a key role in maintaining cellular ion homeostasis during salinity stress . OsNHX1 ( Exchanger) is a transcription factor that regulates and concentration of rice plants when exposed to NaCL and KCl stress . Overexpression of NHX1 in tobacco has been shown to confer salt tolerance . Numerous transcription factors such as DREB, (Dehydration-Responsive Element-Binding) ABRE (ABA-responsive element) and ERF (Ethylene Responsive Factor) have been identified playing an important role in transcriptional regulation under drought stress . Overexpression of HSF2 (Heat Shock Transcription Factor) improved drought tolerance at the seedling stage in Arabidopsos . HSFA3 and HSFA1b take part in different signaling pathways to enhance the plant’s tolerance to drought stress while, the expression of HSFA3 in response to drought stress is dependent upon the expression of DREB2A .
Our study hypothesized that induction of melatonin enhances tolerance to individual as well as combined drought and salt stress in the rice plant. The aim of our study is to evaluate the role of melatonin in rice plants in response to drought and salt stress individually and when they are combined. We focused on the effects of melatonin on morphological parameters, antioxidants and transcriptional regulation of salt and drought responsive genes in response to salt and drought combined stress.

Materials and methods
Plant material and growth conditions

Ilmi rice cultivar (Oryza sativa L.) seeds were used in this experiment, provided by Plant Molecular Breeding Laboratory, Kyungpook National University, Korea . Rice seeds were sterilized with fungicides for a night followed by washing with double distilled water three times. Then, the rice seeds were kept in water for 4 days in an incubator in the dark condition at , changing the water after each 24 h as previously reported by Ref. . After germinating for three days, the seeds were transplanted into plastic pots having I L capacity filled with specialized soil mix (Doobaena plus) consisting of cocopeat ( ), peat moss ( ), vermiculite ( ), Masato , diatomite ( ), bara mesh ( ), fertilizer ( ), and humectant ( ), provided by Nongkyung Co. Ltd, Korea, to foster their growth. The seeds were grown for three weeks in greenhouse for further experiments.

Experimental design

In this experiment, a total of eight groups of rice plants were involved. Each of these groups had three replicates, and within each replicate, there were five plants. The experimental groups were control plants (C), melatonin treated plants (M), salt treated plants (S), drought treated plants (D), salt + drought treated (S + D), salt + melatonin treated plants ( ), drought + melatonin treated plants ( ) and salt + drought + melatonin treated . Water was applied on daily basis. Before 1 week the salt and drought stress exposure plants were treated with of melatonin at alternative days as described by Ref. , and our preliminary screening. For the salt stress, plants were treated with 100 mM of NaCl at three days interval for 3 weeks . For drought stress PEG polyethylene glycol 6000 (PEG 6000; a product of Sigma-Aldrich, Seoul, Korea) was applied, according to method used by Ref. . The experiment involved the random selection of the young fully expanded leaves from each experimental group.

Analysis of morphological parameters and biomass

After 35 days of plant growth, shoot length, root length, height of shoot, and fresh weight (FW) of the rice plants were measured. For the determination of the dry weight (DW) of seedlings, the roots and shoots were dried by oven at for 30 min and maintained at for 48 h to obtain DW. The fresh leaves were put into a petri dish filled with distilled water and the petri dishes were placed in a dark environment for 4 h , and then their turgid weight (TW) was recorded, after that the leaves were oven dried to obtain DW. Finally, relative water content (RWC) was quantified using formula: .

Chlorophyll contents

Chlorophyll contents were measured after 1 week of stress exposure by using portable chlorophyll meter (SPAD 502, Konica Minolta, Japan). The second last fully mature leaf was selected for chlorophyll measurement and the reading was taken from leaf base, middle and near the leaf tip. Five leaves were measured from each treatment group for chlorophyll contents and the average value was taken as SPAD value as mentioned previously .

Electrolyte leakage

For determination of electrolyte leakage, fresh leaves samples were cut into 5 mm and placed in test tubes containing 10 mL deionized water. The tubes were covered with plastic caps and placed in a water bath maintained at the constant temperature of . The initial electrical conductivity (ECI) was measured after 2 h by electrical conductivity meter (CM-115, Kyoto Electronics, Kyoto, Japan). Then the samples were autoclaved at for 20 min to release all electrolytes and kill the tissues. For measurement of final electrical conductivity (EC2), samples were cooled to . Electrolyte leakage (EL) was find out using formula: .

Determination of and MDA contents

contents were measured using previously described method . Briefly, fresh leaves of 0.1 g were ground in liquid nitrogen, extracted in 5 mL of TCA and centrifuged at for 15 min . Supernatant of 0.5 mL was taken, potassium iodide and potassium phosphate buffer of ( 10 mM ) were added, and the absorbance was measured at 390 nm . Using the extinction coefficient content was estimated and expressed as of FW. MDA contents were determined as previously described by Ref. . In brief, fresh plant leaves of 0.1 g were ground in 10 mL of TCA and centrifuged at for 10 min at . The supernatant was taken in 4 mL of TBA, incubated at for 25 min and then cooled down at . The supernatant was read at of 532 and 600 nm . The MDA content was measured as of FW.

Determination of antioxidative activities

Catalase activity was find out by the method of Ref. briefly, crude enzymes was treated with 0.5 mL of 0.2 mM using sodium phosphate buffer with 7 pH . The activity of catalase was determined by the decrease in the absorbance of at 240 nm , and CAT one unit was defined as micromoles of hydrogen peroxide decomposed per minute per milligram of protein. Reduced glutathione contents were determined using the protocol of Ref. , in brief, fresh leaves were ground in liquid nitrogen, trichloroacetic acid was added and centrifuged at for 13 min at . The supernatant was combined with 3 mL of 150 mM (pH 7.4). Then nitrobenzoic acid ( 75.3 mg of DTNB dissolved in 30 mL of 100 Mm sodium phosphate buffer, pH 6.8 ) was added, followed by incubation for 5 min at . At 412 nm the absorbance of the samples was measured, with reference to standard curve, reduced glutathione concentration was calculated and expressed as ( ). All the experiments were performed three times.

RNA isolation and qRT-PCR

To determine expression level of and gene, from each group rice leaves were collected randomly at and 48 h after the plants were exposed to stress. Using RNeasy Plant Mini Kits (50) Qiagen, RNA was extracted, cDNA was synthesized using qPCRBIO kits, while using qPCRBIO SYBR Green kits, qRT-PCR was performed. Primer sequence and accession number of each gene are shown in Table of reaction was started using SYBR green, template DNA, and of each primer. The reaction was incubated at for 2 min , followed by thirty-five cycles at for 10 s , and and for 10 and 40 s , respectively. Each reaction was performed three time using actin as an internal reference gene.
Gene Forward primers Reverse primers Accession no
OsActin CTGCGGGTATCCATGAGACT GGAGCAAGGCAGTGATCTTC X16280.1
OsHSF GCGAGAGAAGCTCAGCTAGG CCCAGACGTAGAATCCGGTG AK101182
OsDREB AGGAGGGAGAAATCTGGCAC CGCACTGAAAAGTGTGGACA AK062422
OsNHX GCGGTGCATTTTGCTCTCAA CCTGCTTCAGATCAGGGTGG AK104336
OsSOS TCGCAGACAGGGTGTTTGAT CGCTTTTGGGTGGAACACAC AK101368
Table 1. Primers and accession numbers of selected genes designed by NCBI for qRT-PCR.

Statistical analysis

All experiments were performed three time. Data were analyzed using two-way ANOVA with Bonferroni post hoc tests (*shows and shows significant difference). For the comparison of the mean values of different treatments completely randomized design was used. Data were graphically presented, and statistical analyses were calculated using the GraphPad Prism software (version 5.01, GraphPad, San Diego, CA, USA) and Statistical Analysis System (SAS 64 bit, developed by North Carolina State University, Raleigh, NC, USA) (Fig. 1).

Results
Plant growth under salt/drought stress and effects of melatonin

In this experiment, we evaluated various growth parameters of rice plants in response to salt and drought combined and individual stress as shown in (Fig. 2A). Both salt and drought stress significantly reduced plant shoot length by in (S), in (D), and in (S + D), and root length by , and compared to (C). However, melatonin treated plants (M) resulted in a increase in plant height compared to to , and to and increase in root length by to to , and to ( ) respectively. Additionally, the application of exogenous melatonin notably raised plant shoot length by in ( ), in ( ), and in ( ), respectively. Likewise, melatonin showed an increase in plant root length by in ( ), in ( ), and in ( ) as compared to their respective stress (S), (D), and (S+D) conditions (Fig. 2B). Salt and drought stress significantly declined shoot fresh weight ( , and ), shoot dry weight ( , and ), root fresh weight ( , and ), and root dry weight ( , and ) in ( ), ( ), and ( ) when compared to ( ). Plants treated exclusively with melatonin (M) exhibited enhanced shoot fresh weight ( , and ), shoot dry weight ( , and ), root fresh weight ( , and ), and root dry weight ( , and ) in comparison to , and . Similarly exogenous application of melatonin significantly induced increases in both fresh and dry weights of the shoot and root. Shoot fresh weight saw increments of in in ( ), and in ( ), while root fresh weight exhibited increases of in (S), in (D), and in (S + D) compared to (S), (D), and (S + D) (Fig. 2C). Moreover, the dry weight of the shoot was enhanced by in ( ), in ( ), and in ( ), while the dry
Figure 1. Experimental design of the experiment, indicating the eight experimental boxes and application of drought and salt stress. Box (A) shows control plants. Box (B) shows plants treated with melatonin only. Box (C) shows the plants exposed to salt stress. Box (D) shows melatonin treated plants exposed to salt stress. Box (E) shows plants exposed to drought stress. Box (F) shows melatonin treated plants exposed to drought stress. Box (G) shows plants exposed to salt and drought combined stress. Box (H) melatonin treated plants exposed to salt and drought combined stress.
Figure 2. Evaluation of growth parameters in rice plants under salt and drought stress. Figures show that melatonin increased the root shoot length and plant biomass in salt and drought stress individually as well as in combined. (A) Shows the salt and drought stress damage. (B) Shoot length, (C) root length, (D) fresh and dry weight. Data were analyzed in three independent biological replicates ( standard deviation, SD), and the means were compared using Dunnett tests. Indicates p and indicates . Whereas C is control, M is melatonin, S is salt, ( ) is salt + melatonin, D is drought, ( ) is drought + melatonin, ( ) is salt + drought and is salt + drought + melatonin.
weight of the root experienced increments of in ( ), in ( ), and in ( ) as compared to (S), (D), and (S+D) (Fig. 2D).

Effects of exogenous melatonin on chlorophyll contents

Salt and drought stress resulted in a significant decrease in chlorophyll contents by , and in (S), (D), and (S+D) compared to the control (C). However, , and of increment was observed in melatonin treated plants ( ) as compared to ( ), ( ), and ( ). Likewise, melatonin treatment led to a notable increase in chlorophyll contents, with increments of in ( ), in ( ), and in ( ) compared to ( S ), (D), and ( ) conditions (Fig. 3A).

Effects of exogenous melatonin on electrolyte leakage

Membrane permeability, as indicated by electrolyte leakage, is notably influenced by both salt and drought stress by in (S), in (D), and in (S+D) as compared to (C). Although Melatonin treatment (M) markedly decreased electrolyte leakage by , and compared to ( ), ( ), and ( ), respectively. Furthermore, exogenous melatonin treatment significantly decreased the electrolyte leakage by in in ( ) and in ( ) respectively as compared to ( S ), (D), and ( ) (Fig. 3B).

Effects of exogenous melatonin on relative water contents

As a measure of plant water status, Relative Water Content (RWC) not only provides insights into the hydration level of a plant but also serves as a reflection of its metabolic activity . RWC is closely related to physiological function of plants, and it also indicates the ability of plant to sustain its water contents and wilting degree of leaves . A significant reduction of under salt stress (S), under drought stress (D), and under
Figure 3. Melatonin application reduces salt and drought stress effects on chlorophyll contents. (A) Shows chlorophyll contents SPAD values. (B) Electrolyte leakage and (C) relative water contents which are regulated by exogenous treatment of melatonin. Data were analyzed in three independent biological replicates ( standard deviation, SD), and the means were compared using Dunnett tests. Indicates and indicates .
combined salt and drought stress ( ) was recorded compared to the control ( C ). While RLW contents were and higher in melatonin-treated plants as compared with ( ), ( ), and ( ). Similarly, melatonin-treated plants exhibited a significant increase in relative water contents, registering a rise of in ( ), in ( ), and in ( ) when compared to ( S ), ( D ), and ( ) conditions (Fig. 3C).

Effects of exogenous melatonin on and MDA contents

Hydrogen peroxide serves as an indicator of the reactive oxygen species (ROS) scavenging capacity in plants under various stresses, and it is generated as a byproduct of cellular metabolism. The results show that showed a substantial increase of under salt stress (S), under drought stress (D), and under combined salt and drought stress ( ) compared to the control ( C ). Melatonin-treated plants ( M ) exhibited a reduction in contents by , and compared to the levels observed in plants under salt stress , drought stress , and combined salt and drought stress , respectively. Furthermore, exogenous application of melatonin demonstrated a substantial reduction in accumulation, showing decreases by in ( ), in ( ), and in ( ) compared to ( S ), ( D ), and ( ) (Fig. 4 A ).
Salt and drought stress demonstrated a notable impact on Malondialdehyde (MDA) contents, elevating the levels by , and in salt-stressed (S), drought-stressed (D), and combined salt and droughtstressed ( ) plants, respectively, compared to the control ( C ). In contrast, melatonin-treated plants ( M ) exhibited a significant reduction in MDA levels by , and compared to plants under salt and melatonin treatment ( ), drought and melatonin treatment ( ), and combined salt, drought, and melatonin treatment ( ), respectively. Similarly, MDA contents were significantly decreased by melatonin treatment, recording reductions of in ( ), in ( ), and in ( ) compared to plants under salt stress (S), drought stress (D), and combined salt and drought stress (S+D) conditions, respectively (Fig. 4B).
Figure 4. Melatonin application alleviates salt and drought stress by scavenging ROS accumulation. (A,B) Shows and MDA contents. Melatonin also regulates the activities of antioxidants. (C) Shows the activities of Glutathione reductase (GR) and (D) shows the activities of catalase (CAT). Data was analyzed in three independent biological replicates ( standard deviation, SD), and the means were compared using Bonferroni post hoc tests. Indicates and indicates .

Melatonin reduce oxidative stress via regulation of GR and CAT

Melatonin provides protection to plants from oxidative damage through the activation of antioxidants. In this study, the effects of salt and drought stress on the antioxidant activities of glutathione (GSH) and catalase (CAT) in rice plants were investigated, with and without melatonin treatment. The results revealed a significant reduction in glutathione (GSH) by , and in salt-stressed (S), drought-stressed (D), and combined salt and drought-stressed ( ) plants compared to the control ( C ). In contrast, melatonin-treated plants ( M ) exhibited a rise in glutathione (GSH) levels by , and compared to plants under salt and melatonin treatment ( ), drought and melatonin treatment ( ), and combined salt, drought, and melatonin treatment ( ), respectively. Similarly, melatonin increased glutathione (GSH) activities by in ( ), in ( ), and in ( ) compared to plants under salt stress ( S ), drought stress ( D ), and combined salt and drought stress (S+D) (Fig. 4C).
The catalase (CAT) activity showed a gradual increase due to salt and drought stress; however, melatonin treatment accelerated its activity. The catalase (CAT) activity increased by under salt stress (S), under drought stress (D), and under combined salt and drought stress (S+D) compared to the control (C). Catalase (CAT) was also recorded higher by , and in salt and melatonin-treated ( ), drought and melatonin-treated ( ), and combined salt, drought, and melatonin-treated ( ) conditions compared to melatonin-treated plants (M). Exogenous melatonin treatment significantly increased catalase (CAT) activity by in (S), in (D), and in (S+D) respectively (Fig. 4D).

Melatonin regulates the salt and drought stress responsive genes

The combined effects of salt and drought stress exert a considerable influence on the expression of genes associated with these stressors. The expression of OsSOS was observed as , and under salt stress (S), and , and under combined salt and drought stress (S+D) at 6,24 , and 48 h following the application of stress, in comparison to control plants (C). Additionally, OsSOS exhibited a significant increase by
, and in (S+M), and , and in (S+D+M) after 6, 24 , and 48 h , respectively, following stress application, in comparison to the expression in melatonin-treated plants (M). Melatonin demonstrated a significant up-regulation in the expression of by , and in ( ) after 6,24 , and 48 h following stress application. Additionally, in (S+D+M), the expression was increased by , and after 6, 24, and 48 h following stress application, respectively, when compared to (S) and (S + D) (Fig. 5A). Similarly, salt and drought stress induced the expression of OsNHX by , and in (S), and , , and in S + D after 6, 24, and 48 h of stress, respectively, compared to control (C) plants. OsNHX displayed a notable increase of , and in (S+M), and , and in (S+D+M) after 6, 24 , and 48 h , respectively, subsequent to stress exposure, in contrast to the expression observed in plants treated solely with melatonin (M) Melatonin up-regulated the expression of OsNHX by , and in (Salt + Melatonin) after 6, 24, and 48 h , and , and in ( ) after 6, 24, and 48 h following stress application, respectively, as compared to (S) and (S+D) (Fig. 5B).
Similarly, the treatment of exogenous melatonin also induced the expression of drought responsive genes OsHSF and OsDREB. OsHSF exhibited a significant increment of , and in drought-stressed (D), and , and in salt and drought-stressed ( ) after 6,12 , and 24 h of stress, respectively, compared to (C). OsHSF exhibited a substantial increase of , and in (S+M), and , and in ( ) after 6, 24, and 48 h , respectively, following stress exposure, compared to the expression observed in plants treated solely with melatonin (M). Melatonin treatment increased the expression of OsHSF by , and in (D+M) after 6, 24 and 48 h and and in (S+D+M) after 6, 24 and 48 h of applying the stress respectively as compared to (D) and (S+D) (Fig. 5C). Salt and drought stress resulted in a significant increase in OsDREB expression, with increments of , and in drought-stressed (D), and
Figure 5. Melatonin reduces salt and drougth stress via regulation of drought and salt stress responsive genes. Show the relative expression of and salt stress responsive gene while, (C,D) show the relative expresssion of and drought responsive genes in rice plant respectively. Data were analyzed in three independent biological replicates ( standard deviation, SD), and the means were compared using Bonferroni post hoc tests. Indicates and indicates .
, and in salt and drought-stressed (S + D) after 6, 12, and 24 h of stress, respectively, compared to control (C). OsDREB exhibited a significant increase of , and in (S+M), and , and in ( ) after 6, 24, and 48 h , respectively, following stress exposure, compared to the expression observed in plants treated solely with melatonin (M). Similarly, melatonin significantly increased the expression of OsDRED by and in (D+M) after 6, 24 and 48 h and and in ( ) after 6, 24 and 48 h respectively as compared to (D) and (S+D) (Fig. 5D).

Discussion

In this study, both salt and drought stress, either independently or in combination, resulted in a substantial depletion in rice growth (Fig. 2). The inhibition of new leaf growth and the development of the root system due to drought and salt stress are widely acknowledged factors contributing to the reduction in biomass accumulation . Salinity and drought stress significantly reduce seed germination rates, shoot, and root length, as well as the overall biomass of rice seedlings, resulting in hindering plant growth . This study confirms that both salinity and drought stress severely restricted the growth and development of rice, as shown in (Fig. 2A,B). And these stressors significantly reduced both above-ground fresh weight and dry weight, as depicted in (Fig. 2C,D). Moreover, the inhibitory effect on plant growth and biomass was more pronounced under salt stress compared to drought stress. Furthermore, chlorophyll plays essential roles in plant growth, development, and the synthesis of photosynthetic products. Salt stress hinders chlorophyll synthesis, directly impacting photosynthesis, retarding plant growth, and diminishing yield . In this experiment, during salt and drought stress, chlorophyll contents were significantly reduced (Fig. 3A). This may be due to rise in the level of , MDA, and , disrupting chloroplast membrane stability and causing degradation of the protein-pigment-lipid complex . Exogenous application of melatonin reversed the downward trend and promoted plant growth, biomass, and chlorophyll contents (Fig. 3C,D). These findings align with prior research , suggesting the potential impact of melatonin on enzymes contributes to the enhancement of chlorophyll level , thereby promoting plant growth and development.
The findings from this study indicate that elevated salt and drought stress levels led to a decrease in RLWC (Relative Leaf Water Content). This decline in RLWC may have contributed to a reduction in various plant growth factors . Prior treatment with melatonin notably enhanced Relative Leaf Water Content (RLWC) in rice plants under both salt and drought stress conditions (Fig. 3C). These outcomes are consistent with earlier findings from Ref. , the observed rise in RLWC could be attributed to melatonin’s potential involvement in modulating stomatal behavior, effectively regulating their opening and closure to prevent undue water loss from leaves . Electrolyte Leakage (EL) serves as an indicator of alterations in cell membrane structure during high salt and water deficit conditions. Our results show a notable increment in electrolyte leakage during salt and drought stress (Fig. 3B). Utilizing its relative conductivity allows for the assessment of damage to both the structure and function of cell membranes under various stresses . Melatonin pre-treatment significantly decreased electrolyte leakage during salt and drought stress in rice plants. Similar results were obtained by Ref. in drought and Ref. in salt stress conditions. Consequently, the decrease in electrolyte leakage may be associated with elevated levels of CAT (catalase) and GSH (glutathione) by melatonin treatment during salt and drought stress conditions. This indicates that the utilization of melatonin might mitigate oxidative harm induced by salinity and drought stress.
Both salt and drought stress in rice plants trigger the excessive production of reactive oxygen species (ROS), which then leads to damage within various biomolecules. This disruption in the equilibrium between ROS generation and elimination adds to the overall oxidative stress within the plant’s system . Melatonin is believed to act as an antioxidant in plants, aiding in cellular redox regulation, scavenging reactive oxygen species (ROS), and stabilizing plant cell membranes, thus offering protection against various environmental stressors . Our results show that melatonin pre-treatment in rice suppressed the accumulation of ROS during salt and drought stress (Fig. 4A,B). These findings align with previous observations indicating that melatonin reduces ROS accumulation in watermelon and cucumber subjected to salt stress in maize and soybean subjected to drought stress with respect to non-treated plants.
Moreover, Li et al. reported that the application of exogenous melatonin enhanced plants’ tolerance to cold, drought, and salt stress. This effect was attributed to a reduction in reactive oxygen species (ROS) burst, maintenance of photosynthetic efficiency, decrease in malondialdehyde (MDA) levels, and enhancement of antioxidant activity in tea plants. Melatonin may have the capacity to enhance cellular redox homeostasis by stimulating the entire antioxidant system, encompassing both antioxidant enzymes (e.g., catalase, superoxide dismutase, peroxidase, ascorbate peroxidase, and monodehydroascorbate reductase) and non-enzymatic antioxidants (such as glutathione and ascorbate) , as well as elevating levels of polyphenols , carotenoids , and anthocyanins , to protect plants from abiotic stress-induced oxidative stress. Nonetheless, the precise mechanisms underlying this stimulatory action remain unclear. It is yet to be determined whether melatonin’s effect results from a direct interaction with existing enzymes or if it involves signal transduction mechanisms that regulate gene expression, leading to increased enzyme production.
During normal conditions, plants effectively neutralize reactive oxygen species (ROS) through both non-enzymatic and enzymatic antioxidants. However, under salt and drought conditions, the ROS production surpasses the capacity of the antioxidant defense systems, resulting in oxidative stress within the plant . Catalase (CAT) and glutathione (GSH) are crucial antioxidants involved in vital processes within plant cells. Several studies on plants with altered levels of CAT and GSH proved the important roles of CAT and GSH in the tolerance of plants to environmental stresses . The results of our study show that salt and drought stress slightly increase the level of CAT as shown in the (Fig. 4D). This slight increase in CAT activity may be due to its activation to encounter the accumulation of induced by water shortage and salinity stress . The findings from this study align with previous research indicating that plants respond to oxidative damage induced by various stressors by deploying
mechanisms to maintain cellular equilibrium and withstand abiotic stress . When the levels of glutathione within cells become more oxidized or decrease due to environmental factors, it triggers a signaling process, which prompts cells to react as though their glutathione levels are persistently low, assisting in their adaptation to changes in the environment . The metabolism of glutathione (GSH) and the maintenance of the GSH pool are integral to plant responses to various abiotic stresses . Several studies have highlighted a reduction in glutathione (GSH) levels in various plant species under stress conditions like salinity, extreme temperatures, and heavy metal exposure . The study’s findings indicate a decline in GSH levels during salt and drought stress, as depicted in (Fig. 4C). This trend might be attributed to the activation of NADPH oxidase, which has a direct correlation with both ROS production and GSH levels . However exogenous treatment of melatonin significantly increased the CAT and GSH activity during salt and drought stress (Fig. 4D). The results obtained in this study align with previous findings. Exogenous application of melatonin significantly boosted the activity of CAT in Zea mays L. and Cynodon dactylon L. when subjected to salinity stress . Additionally, melatonin treatment has also shown an increase in CAT activity under various combined stresses like salinity and heat, drought, and cold stress . In a plant cell, superoxide anion ( ) can be rapidly converted to hydrogen peroxide ( ) by superoxide dismutase (SOD), while can be scavenged by catalase (CAT) , and melatonin’s involvement in boosting CAT activity contributes to maintaining the balance of reactive oxygen species (ROS) within the plant system. Similarly, melatonin plays a significant role in modulating glutathione (GSH) activity during abiotic stress conditions. Melatonin application appears to elevate the levels of Glutathione (GSH) in different plants after exposure to salt , drought , and heat stress . Our study’s findings align with these results, as depicted in (Fig. 4C), which underscores the role of melatonin in enhancing GSH activity during stress conditions. The elevated GSH levels attributed to melatonin may indicate its role in modulating the AsA-GSH cycle, which plays a crucial role to detoxify the and provide protection to plants from environmental stresses .
Further we studied OsSOS, NHX, HSF and DREB’s expression level under salt and drought stress with different time points in response to melatonin. These genes are extensively studied and regarded as controllers of drought and salt stress response in rice plants. Different concentration of salt influence gene expression in rice, such as SOS2, and NHX were over expressed and directly activated the expression of transporters, and regulate salt tolerance . The expression of OsSOS1 and OsNHX1 was up-regulated in rice seedling by applying 100 mM of . Overexpression of under 150 mM of NaCl treatment showed improvement in growth parameters and retain relative water contents . OsNHX genes play a crucial role in regulating the sodium ( ) and potassium ( ) concentrations within the rice cytoplasm, aiding in the plant’s ability to manage and withstand salinity stress . The OsNHX family genes exhibit regulation in salinity stressed rice plants, and the overexpression of OsNHX1 imparts resistance to salinity stress in transgenic rice . In accordance with Cattarin et al. , who noted an increase in OsNHX1 expression in the leaves of Pokkali and IR29 rice seedlings under 200 mM salinity stress, our study observed up-regulation of OsSOS and OsNHX in plants subjected to both salt stress and combined salt and drought stress (Fig. 5A,B). Exogenous melatonin improved salt tolerance by up-regulating the expression of SOS pathway in Malus hupehensis and SOS1, SOS2, and SOS3 genes under salinity stress in Chinese medicinal herbs . Melatonin treated plants showed over expression of ion transport proteins NHX1 and during exposure to salt stress . Consistent with previous findings, this study affirms that the external application of melatonin significantly contributes to alleviating salt stress by modulating the expression of SOS and NHX genes (Fig. 5A,B). Pretreatment with melatonin has been shown to boost the transcription of OsSOS and in rice plants during salt stress, aiding in the removal of and maintaining plant resistance .
Studies show that different transcription factors were identified which play an important role in the regulation of plants responses to different stresses . In rice cultivar AP2 transcription activators OsDREB1A is upregulated during drought and high salt stress . OsDREB1B and DREB1A were up-regulated in Arabidopsis to enhanced dehydration and high salinity . Over expression of HSFA1 and HSFA2 genes have been reported in soyabean, tomato and Arabidopsis to improve plant heat resistance . A recent study showed that OsHSFC1b is overexpressed to improve salt tolerance in rice plants . Moreover Scharf et al. confirmed that HSFA3 is a part of drought stress signaling. The results of our study demonstrated that OsHSF and DREB are up-regulated in individual drought stress and drought, salinity combined stress (Fig. 5C,D), that show that OsHSF and DREB are the important transcriptional regulator during drought stress in rice plants. Exogenous treatment of melatonin enhanced carbohydrate metabolism and up-regulated transcription factors such as DREB, HSF, WRKY, and MYB in different plants . Melatonin regulates various transcription factors like DREB in cotton , and DREB2A in Arabidopsis under salinity and drought stress conditions . In our study, melatonin treatment significantly elevated the expression of OsHSF and DREB genes in rice plants subjected to salt, drought stress individually, and their combined stress conditions (Fig. 5C,D). To summarize, there is a hypothesis that melatonin enhances rice plants’ response to salt and drought stress. In summary, it is hypothesized that melatonin improves the response of rice plants to salt and drought stress. Melatonin encounters the production of ROS within cells. As ROS levels rise, melatonin acts as an antioxidant, scavenging these ROS and boosting antioxidant activities. Melatonin seems to induce or activate the expression of specific resistance genes, thereby enhancing the plant’s ability to tolerate salt and drought stress. Further investigation is needed to comprehensively understand the mechanisms and signaling pathways involved in melatonin’s response under salt and drought stress in rice plants.

Conclusion

Our study showed that both the salt and drought stresses induced oxidative damage by generation of ROS and membrane damage due to lipid peroxidation, which leads to reduction in rice plant growth and development. Exogenous melatonin application reduces salt, drought stress individually as well as in combine. Melatonin increased fresh and dry weight of rice under salt and drought stress. Similarly, melatonin treatment significantly reduced the accumulation of ROS and increased the antioxidant activity. Moreover, melatonin up-regulated the
genes expression that are responsible for ion homeostasis. Future perspectives entail unraveling melatonin’s precise mechanisms, optimizing its application strategies, and validating its effectiveness in field trials for sustainable crop resilience under salt and drought stresses.

Statement of adherence of the study to IUCN guidelines

The current study complies with relevant guidelines of IUCN Policy Statement on Research Involving Species at Risk of Extinction and Convention on the Trade in Endangered Species of Wild Fauna and Flora.

Data availability

The data presented in this study are available on request from the corresponding author.
Received: 17 October 2023; Accepted: 4 January 2024
Published online: 12 January 2024

References

  1. Sen, S., Chakraborty, R. & Kalita, P. Rice-not just a staple food: A comprehensive review on its phytochemicals and therapeutic potential. Trends Food Sci. Technol. 97, 265-285 (2020).
  2. Fan, X. et al. Effects of high temperature on the fine structure of starch during the grain-filling stages in rice: Mathematical modeling and integrated enzymatic analysis. J. Sci. Food Agric. 99, 2865-2873 (2019).
  3. Fitzgerald, M. A., McCouch, S. R. & Hall, R. D. Not just a grain of rice: The quest for quality. Trends Plant Sci. 14, 133-139 (2009).
  4. Battisti, D. S. & Naylor, R. L. Historical warnings of future food insecurity with unprecedented seasonal heat. Science 323, 240-244 (2009).
  5. Nam, W.-H., Hayes, M. J., Svoboda, M. D., Tadesse, T. & Wilhite, D. A. Drought hazard assessment in the context of climate change for South Korea. Agric. Water Manag. 160, 106-117 (2015).
  6. Cook, B. I., Mankin, J. S. & Anchukaitis, K. Climate change and drought: From past to future. Curr. Clim. Change Rep. 4, 164-179 (2018).
  7. Sheffield, J. & Wood, E. F. Drought: Past Problems and Future Scenarios (Routledge, 2012).
  8. Allen, R. G. Crop evapotranspiration-Guideline for computing crop water requirements. Irrig. Drain 56, 300 (1998).
  9. Mostajeran, A. & Rahimi-Eichi, V. Effects of drought stress on growth and yield of rice (Oryza sativa L.) cultivars and accumulation of proline and soluble sugars in sheath and blades of their different ages leaves. Agric. Environ. Sci. 5, 264-272 (2009).
  10. Pandey, S., Bhandari, H. S. & Hardy, B. Economic Costs of Drought and Rice Farmers’ Coping Mechanisms: A Cross-Country Comparative Analysis (International Rice Research Institute, 2007).
  11. Thitisaksakul, M. et al. Effects of timing and severity of salinity stress on rice (Oryza sativa L.) yield, grain composition, and starch functionality. J. Agric. Food Chem. 68, 2296-2304 (2015).
  12. Hussain, S. et al. Effects of salt stress on rice growth, development characteristics, and the regulating ways: A review. J. Integr. Agric. 16, 2357-2374 (2017).
  13. Hussain, S. et al. Effects of 1-methylcyclopropene on rice growth characteristics and superior and inferior spikelet development under salt stress. J. Plant Growth Regul. 37, 1368-1384 (2018).
  14. Tarakcioglu, C. & Inal, A. Changes induced by salinity, demarcating specific ion ratio ( ) and osmolality in ion and proline accumulation, nitrate reductase activity, and growth performance of lettuce. J. Plant Nutr. 25, 27-41 (2002).
  15. Gunes, A. et al. Salicylic acid induced changes on some physiological parameters symptomatic for oxidative stress and mineral nutrition in maize (Zea mays L.) grown under salinity. J. Plant Physiol. 164, 728-736 (2007).
  16. Munns, R. Comparative physiology of salt and water stress. Plant Cell Environ. 25, 239-250 (2002).
  17. Shereen, A., Mumtaz, S., Raza, S., Khan, M. & Solangi, S. Salinity effects on seedling growth and yield components of different inbred rice lines. Pak. J. Bot. 37, 131-139 (2005).
  18. Reiter, R. J., Tan, D. X. & Galano, A. Melatonin: Exceeding expectations. Physiology 29, 325 (2014).
  19. Hardeland, R., Madrid, J. A., Tan, D. X. & Reiter, R. J. Melatonin, the circadian multioscillator system and health: The need for detailed analyses of peripheral melatonin signaling. J. Pineal Res. 52, 139-166 (2012).
  20. Calvo, J. R., Gonzalez-Yanes, C. & Maldonado, M. The role of melatonin in the cells of the innate immunity: A review. J. Pineal Res. 55, 103-120 (2013).
  21. Hardeland, R., Reiter, R., Poeggeler, B. & Tan, D.-X. The significance of the metabolism of the neurohormone melatonin: Antioxidative protection and formation of bioactive substances. Neurosci. Biobehav. Rev. 17, 347-357 (1993).
  22. Dubbels, R. et al. Melatonin in edible plants identified by radioimmunoassay and by high performance liquid chromatographymass spectrometry. J. Pineal Res. 18, 28-31 (1995).
  23. Zhang, N. et al. Melatonin promotes water-stress tolerance, lateral root formation, and seed germination in cucumber (Cucumis sativus L.). J. Pineal Res. 54, 15-23 (2013).
  24. Bajwa, V. S., Shukla, M. R., Sherif, S. M., Murch, S. J. & Saxena, P. K. Role of melatonin in alleviating cold stress in Arabidopsis thaliana. J. Pineal Res. 56, 238-245 (2014).
  25. Sharma, A. & Zheng, B. Melatonin mediated regulation of drought stress: Physiological and molecular aspects. Plants 8, 190 (2019).
  26. Tiwari, R. K. et al. Mechanistic insights on melatonin-mediated drought stress mitigation in plants. Physiol. Plant. 172, 1212-1226 (2021).
  27. Arnao, M. B. & Hernández-Ruiz, J. Melatonin: Plant growth regulator and/or biostimulator during stress? Trends Plant Sci. 19, 789-797 (2014).
  28. Yan, F. et al. Melatonin regulates antioxidant strategy in response to continuous salt stress in rice seedlings. Plant Physiol. 165, 239-250 (2021).
  29. Alharby, H. F. & Fahad, S. Melatonin application enhances biochar efficiency for drought tolerance in maize varieties: Modifications in physio-biochemical machinery. Agron. J. 112, 2826-2847 (2020).
  30. Ibrahim, W. et al. Comparative physiological analysis in the tolerance to salinity and drought individual and combination in two cotton genotypes with contrasting salt tolerance. Physiol. Plant. 165, 155-168 (2019).
  31. Anwar, K., Joshi, R., Dhankher, O. P., Singla-Pareek, S. L. & Pareek, A. Elucidating the response of crop plants towards individual, combined and sequentially occurring abiotic stresses. Int. J. Mol. Sci. 22, 6119 (2021).
  32. Kumar, G., Basu, S., Singla-Pareek, S. L. & Pareek, A. Unraveling the contribution of OsSOS2 in conferring salinity and drought tolerance in a high-yielding rice. Physiol. Plant. 174, e13638 (2022).
  33. Fukuda, A. et al. Function, intracellular localization and the importance in salt tolerance of a vacuolar antiporter from rice. Plant Cell Physiol. 45, 146-159 (2004).
  34. Lü, S. Y. et al. Antiporter gene from Hordum brevisubulatum (Trin.) link and its overexpression in transgenic tobaccos. J. Integr. Plant Biol. 47, 343-349 (2005).
  35. Singh, D. & Laxmi, A. Transcriptional regulation of drought response: A tortuous network of transcriptional factors. Front. Plant Sci. 6, 895 (2015).
  36. Joshi, R. et al. Transcription factors and plants response to drought stress: Current understanding and future directions. Front. Plant Sci. 7, 1029 (2016).
  37. Mao, X. et al. TaNAC2, a NAC-type wheat transcription factor conferring enhanced multiple abiotic stress tolerances in Arabidopsis. J. Exp. Bot. 63, 2933-2946 (2012).
  38. Scharf, K.-D., Berberich, T., Ebersberger, I. & Nover, L. The plant heat stress transcription factor (Hsf) family: Structure, function and evolution. Biochim. Biophys. Acta Gene Regul. Mech. 1819, 104-119 (2012).
  39. Jan, R., Khan, M. A., Asaf, S., Lee, I.-J. & Kim, K.-M. Overexpression of OsF 3 H modulates WBPH stress by alteration of phenylpropanoid pathway at a transcriptomic and metabolomic level in Oryza sativa. Sci. Rep. 10, 14685 (2020).
  40. Ahmad, S. et al. Exogenous melatonin confers drought stress by promoting plant growth, photosynthetic capacity and antioxidant defense system of maize seedlings. PeerJ 7, e7793 (2019).
  41. Schmidt, R. et al. SALT-RESPONSIVE ERF1 regulates reactive oxygen species-dependent signaling during the initial response to salt stress in rice. Plant Cell 25, 2115-2131 (2013).
  42. Jan, R. et al. Drought and UV radiation stress tolerance in rice is improved by overaccumulation of non-enzymatic antioxidant flavonoids. Antioxidants 11, 917 (2022).
  43. Bastam, N., Baninasab, B. & Ghobadi, C. Improving salt tolerance by exogenous application of salicylic acid in seedlings of pistachio. Plant Growth Regul. 69, 275-284 (2013).
  44. Khan, M. A. et al. Halotolerant rhizobacterial strains mitigate the adverse effects of NaCl stress in soybean seedlings. BioMed Res. Int. 2019, 1 (2019).
  45. Velikova, V., Yordanov, I. & Edreva, A. Oxidative stress and some antioxidant systems in acid rain-treated bean plants: Protective role of exogenous polyamines. Plant Sci. 151, 59-66 (2000).
  46. Khan, M. A. et al. Halo-tolerant rhizospheric Arthrobacter woluwensis AK1 mitigates salt stress and induces physio-hormonal changes and expression of GmST1 and GmLAX3 in soybean. Symbiosis 77, 9-21 (2019).
  47. Johansson, L. H. & Borg, L. H. A spectrophotometric method for determination of catalase activity in small tissue samples. Arch. Biochem. 174, 331-336 (1988).
  48. Ellman, G. L. Tissue sulfhydryl groups. Arch. Biochem. 82, 70-77 (1959).
  49. Huang, C. et al. Alteration in chlorophyll fluorescence, lipid peroxidation and antioxidant enzymes activities in hybrid ramie (Boehmeria nivea L.) Under drought stress. Austral. J. Crop Sci. 7, 594-599 (2013).
  50. Yang, S. & Deng, X. Effects of drought stress on antioxidant enzymes in seedlings of different wheat genotypes. Pak. J. Bot. 47, 49-56 (2015).
  51. Xiaoqin, Y., Jianzhou, C. & Guangyin, W. Effects of drought stress and selenium supply on growth and physiological characteristics of wheat seedlings. Acta Physiol. Plant. 31, 1031-1036 (2009).
  52. Khan, M. A., Gemenet, D. C. & Villordon, A. Root system architecture and abiotic stress tolerance: Current knowledge in root and tuber crops. Front. Plant Sci. 7, 1584 (2016).
  53. Luo, C. et al. Melatonin enhances drought tolerance in rice seedlings by modulating antioxidant systems, osmoregulation, and corresponding gene expression. Int. J. Mol. Sci. 23, 12075 (2022).
  54. Talubaghi, M. J., Daliri, M. S., Mazloum, P., Rameeh, V. & Mousavi, A. Effect of salt stress on growth, physiological and biochemical parameters and activities of antioxidative enzymes of rice cultivars. Cereal Res. Commun. 51, 403-411 (2023).
  55. Shahid, M. A. et al. Insights into the physiological and biochemical impacts of salt stress on plant growth and development. Agron. J. 10, 938 (2020).
  56. Mushtaq, Z. et al. Changes in growth, photosynthetic pigments, cell viability, lipid peroxidation and antioxidant defense system in two varieties of chickpea (Cicer arietinum L.) subjected to salinity stress. Phyton 91, 149 (2022).
  57. Imran, M. et al. Exogenous melatonin induces drought stress tolerance by promoting plant growth and antioxidant defence system of soybean plants. AoB Plants 13, 026 (2021).
  58. Arnao, M. & Hernández-Ruiz, J. Protective effect of melatonin against chlorophyll degradation during the senescence of barley leaves. J. Pineal Res. 46, 58-63 (2009).
  59. Ghanbari, F. & Sayyari, M. Controlled drought stress affects the chilling-hardening capacity of tomato seedlings as indicated by changes in phenol metabolisms, antioxidant enzymes activity, osmolytes concentration and abscisic acid accumulation. Sci. Hortic. 229, 167-174 (2018).
  60. Turk, H. et al. The regulatory effect of melatonin on physiological, biochemical and molecular parameters in cold-stressed wheat seedlings. Plant Growth Regul. 74, 139-152 (2014).
  61. Xu, X. D., Sun, Y., Sun, B., Zhang, J. & Guo, X. Q. Effects of exogenous melatonin on active oxygen metabolism of cucumber seedlings under high temperature stress. J. Appl. Ecol. 21, 1295-1300 (2010).
  62. Jungklang, J., Saengnil, K. & Uthaibutra, J. Effects of water-deficit stress and paclobutrazol on growth, relative water content, electrolyte leakage, proline content and some antioxidant changes in Curcuma alismatifolia Gagnep. cv. Chiang Mai Pink. Saudi J. Biol. Sci. 24, 1505-1512 (2017).
  63. Cui, G. et al. Beneficial effects of melatonin in overcoming drought stress in wheat seedlings. Plant Physiol. Biochem. 118, 138-149 (2017).
  64. Altaf, M. et al. Exogenous melatonin enhances salt stress tolerance in tomato seedlings. Biol. Plant. 64, 604-615 (2020).
  65. Das, K. & Roychoudhury, A. Reactive oxygen species (ROS) and response of antioxidants as ROS-scavengers during environmental stress in plants. Front. Environ. Sci. 2, 53 (2014).
  66. Tan, D. et al. Chemical and physical properties and potential mechanisms: Melatonin as a broad spectrum antioxidant and free radical scavenger. Curr. Top. Med. Chem. 2, 181-197 (2002).
  67. Li, H. et al. Exogenous melatonin confers salt stress tolerance to watermelon by improving photosynthesis and redox homeostasis. Front. Plant Sci. 8, 295 (2017).
  68. Zhao, H. et al. Melatonin increases the chilling tolerance of chloroplast in cucumber seedlings by regulating photosynthetic electron flux and the ascorbate-glutathione cycle. Front. Plant Sci. 7, 1814 (2016).
  69. Li, J. et al. Alleviation of cold damage by exogenous application of melatonin in vegetatively propagated tea plant (Camellia sinensis (L.) O. Kuntze). Sci. Hortic. 238, 356-362 (2018).
  70. Tomás-Zapico, C. & Coto-Montes, A. A proposed mechanism to explain the stimulatory effect of melatonin on antioxidative enzymes. J. Pineal Res. 39, 99-104 (2005).
  71. Reiter, R. J. et al. Melatonin as an antioxidant: Biochemical mechanisms and pathophysiological implications in humans. Acta Biochim. Polon. 50, 1129-1146 (2003).
  72. Wu, S. et al. Drought stress tolerance mediated by zinc-induced antioxidative defense and osmotic adjustment in cotton (Gossypium hirsutum). Acta Physiol. Plant. 37, 1-9 (2015).
  73. Zhang, N. et al. Melatonin improved anthocyanin accumulation by regulating gene expressions and resulted in high reactive oxygen species scavenging capacity in cabbage. Front. Plant Sci. 7, 197 (2016).
  74. Morales, F., Abadía, A. & Abadba, J. Photoprotection, Photoinhibition, Gene Regulation, and Environment 65-85 (Springer, 2008).
  75. Ball, L. et al. Evidence for a direct link between glutathione biosynthesis and stress defense gene expression in Arabidopsis. Plant Cell 16, 2448-2462 (2004).
  76. Pan, Y., Wu, L. J. & Yu, Z. L. Effect of salt and drought stress on antioxidant enzymes activities and SOD isoenzymes of liquorice (Glycyrrhiza uralensis Fisch). Plant Growth Regul. 49, 157-165 (2006).
  77. Yildiztugay, E., Ozfidan-Konakci, C., Kucukoduk, M., Tekis, S. A. & Science, S. The impact of selenium application on enzymatic and non-enzymatic antioxidant systems in Zea mays roots treated with combined osmotic and heat stress. Arch. Agron. 63, 261-275 (2017).
  78. Schafer, F. Q. & Buettner, G. R. Redox environment of the cell as viewed through the redox state of the glutathione disulfide/ glutathione couple. Free Radic. Biol. Med. 30, 1191-1212 (2001).
  79. Zhang, W., Tian, Z., Pan, X., Zhao, X. & Wang, F. Oxidative stress and non-enzymatic antioxidants in leaves of three edible canna cultivars under drought stress. Hortic. Environ. Biotechnol. 54, 1-8 (2013).
  80. Tepe, M. & Harms, H. Influence of abiotic stress on the GSH/GSSG system of plant cell cultures. Mol. Biol. Plants 158, 75-78 (1995).
  81. Dash, S. & Mohanty, N. Response of seedlings to heat-stress in cultivars of wheat: Growth temperature-dependent differential modulation of photosystem 1 and 2 activity, and foliar antioxidant defense capacity. J. Plant Physiol. 159, 49-59 (2002).
  82. De Vos, C. R., Vonk, M. J., Vooijs, R. & Schat, H. Glutathione depletion due to copper-induced phytochelatin synthesis causes oxidative stress in Silene cucubalus. Plant Physiol. 98, 853-858 (1992).
  83. Liu, T., Sun, L., Zhang, Y., Wang, Y. & Zheng, J. Imbalanced GSH/ROS and sequential cell death. J. Biochem. Mol. Toxicol. 36, e22942 (2022).
  84. Chen, Y. E. et al. Exogenous melatonin enhances salt stress tolerance in maize seedlings by improving antioxidant and photosynthetic capacity. Physiol. Plant. 164, 349-363 (2018).
  85. Liang, D. et al. Melatonin improves heat tolerance in kiwifruit seedlings through promoting antioxidant enzymatic activity and glutathione S-transferase transcription. Molecules 23, 584 (2018).
  86. Huang, B. et al. Exogenous melatonin alleviates oxidative damages and protects photosystem II in maize seedlings under drought stress. Front. Plant Sci. 10, 677 (2019).
  87. Foyer, C. H. & Noctor, G. Ascorbate and glutathione: The heart of the redox hub. Plant Physiol. 155, 2-18 (2011).
  88. Wei, J. et al. Phytomelatonin receptor PMTR 1-mediated signaling regulates stomatal closure in Arabidopsis thaliana. J. Pineal Res. 65, e12500 (2018).
  89. Liu, C. et al. OsbZIP71, a bZIP transcription factor, confers salinity and drought tolerance in rice. Plant Mol. Biol. 84, 19-36 (2014).
  90. Wang, H. et al. Effects of salt stress on ion balance and nitrogen metabolism of old and young leaves in rice (Oryza sativa L.). BMC Plant Biol. 12, 1-11 (2012).
  91. Fukuda, A., Nakamura, A., Hara, N., Toki, S. & Tanaka, Y. Molecular and functional analyses of rice NHX-type Na+/H+ antiporter genes. Plant Physiol. 233, 175-188 (2011).
  92. Theerawitaya, C., Tisarum, R., Samphumphuang, T., Takabe, T. & Cha-Um, S. Expression levels of the Na+/K+ transporter OsHKT2; 1 and vacuolar exchanger OsNHX1, Na enrichment, maintaining the photosynthetic abilities and growth performances of Indica rice seedlings under salt stress. Physiol. Mol. Biol. Plants 26, 513-523 (2020).
  93. Li, C. et al. Melatonin mediates the regulation of ABA metabolism, free-radical scavenging, and stomatal behaviour in two Malus species under drought stress. J. Exp. Bot. 66, 669-680 (2015).
  94. Chen, G. et al. Melatonin in Chinese medicinal herbs. Life Sci. 73, 19-26 (2003).
  95. Yan, F. et al. Melatonin enhances homeostasis in rice seedlings under salt stress through increasing the root pump activity and transporters sensitivity to ROS/RNS. Environ. Exp. Bot. 182, 104328 (2021).
  96. Singh, K. B., Foley, R. C. & Oñate-Sánchez, L. Transcription factors in plant defense and stress responses. Curr. Opin. Plant Biol. 5, 430-436 (2002).
  97. Dubouzet, J. G. et al. OsDREB genes in rice, Oryza sativa L., encode transcription activators that function in drought-, high-salt-and cold-responsive gene expression. Plant J. 33, 751-763 (2003).
  98. Kasuga, M., Liu, Q., Miura, S., Yamaguchi-Shinozaki, K. & Shinozaki, K. Improving plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible transcription factor. Nat. Biotechnol. 17, 287-291 (1999).
  99. Liu, J.-G. et al. OsHSF7 gene in rice, Oryza sativa L., encodes a transcription factor that functions as a high temperature receptive and responsive factor. BMB Rep. 42, 16-21 (2009).
  100. Charng, Y.-Y. et al. A heat-inducible transcription factor, HsfA2, is required for extension of acquired thermotolerance in Arabidopsis. Plant Physiol. 143, 251-262 (2007).
  101. Han, G. et al. C2H2 zinc finger proteins: Master regulators of abiotic stress responses in plants. Front. Plant Sci. 11, 115 (2020).
  102. Shi, H., Chen, K., Wei, Y. & He, C. Fundamental issues of melatonin-mediated stress signaling in plants. Front. Plant Sci. 7, 1124 (2016).
  103. Zhang, L. et al. A cotton group C MAP kinase gene, GhMPK2, positively regulates salt and drought tolerance in tobacco. Plant Mol. Biol. 77, 17-31 (2011).

Author contributions

Z.K., R.J., and K.-M.K.; designed the study; Z.K., R.J., S.A., and M.-F., performed the experiments; E.-G.K., Y.H.J., and N.K., contributed to statistical analysis; Z.K., R.J., and K.-M.K.; wrote the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was conducted with the support of “Cooperative Research Program for Agriculture Science and Technology Development (Project No. RS-2022-RD010034)” Rural Development Administration, Republic of Korea. The funding was also provided by Cooperative Research Program for Agriculture Science and Technology Rural Development Administration, Republic of Korea Development, Project No. RS-2023-00217583.

Competing interests

The authors declare no competing interests.

Additional information

Correspondence and requests for materials should be addressed to R.J. or K.-M.K.
Reprints and permissions information is available at www.nature.com/reprints.
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
© The Author(s) 2024
  1. Department of Applied Biosciences, Graduate School, Kyungpook National University, Daegu 41566, South Korea. Coastal Agriculture Research Institute, Kyungpook National University, Daegu 41566, South Korea. email: rehmatbot@yahoo.com; kkm@knu.ac.kr