حمض الدوكوساهيكسانويك الغذائي (DHA) يقلل من تخليق DHA في الكبد عن طريق تثبيط إطالة حمض الإيكوسابنتاينويك Dietary docosahexaenoic acid (DHA) downregulates liver DHA synthesis by inhibiting eicosapentaenoic acid elongation

المجلة: Journal of Lipid Research، المجلد: 65، العدد: 6
DOI: https://doi.org/10.1016/j.jlr.2024.100548
PMID: https://pubmed.ncbi.nlm.nih.gov/38649096
تاريخ النشر: 2024-04-21

حمض الدوكوساهيكسانويك الغذائي (DHA) يقلل من تخليق DHA في الكبد عن طريق تثبيط إطالة حمض الإيكوسابنتاينويك

آدم إتش. ميثيريل رودريغو فالينزويلا برينلي ج. كليفيك جوليا سيزبانى ® ، روكساندرا د. روتارسكو ميليسا غونزاليس-سوتو سيلين كروسياني-غوغلياماسي صوفي لاي كريستوف ماغنان ديفيد م. موتش وريتشارد ب. بازينت قسم علوم التغذية، جامعة تورونتو، تورونتو، أونتاريو، كندا؛ قسم التغذية، جامعة تشيلي، سانتياغو، تشيلي؛ قسم صحة الإنسان وعلوم التغذية، جامعة غويلف، غويلف، أونتاريو، كندا؛ BFA، UMR8251، CNRS، جامعة باريس سيتé، باريس، فرنسا؛ و INRA، Bordeaux INP، NutriNeuro، جامعة بوردو، بوردو، فرنسا

الملخص

حمض الدوكوساهيكسانويك (DHA) وفير في الدماغ حيث ينظم بقاء الخلايا، وتكوين الأعصاب، والالتهاب العصبي. يمكن الحصول على DHA من النظام الغذائي أو تصنيعه من حمض ألفا-لينولينيك (ALA؛ 18:3n-3) من خلال سلسلة من تفاعلات الإشباع والإطالة التي تحدث في الكبد. تشير دراسات التتبع إلى أن DHA الغذائي يمكن أن يقلل من تصنيع نفسه، لكن الآلية لا تزال غير محددة وهي الهدف الرئيسي من هذه المخطوطة. أولاً، نوضح من خلال تتبع المحتوى ( من خلال تحليل النظائر المحددة للمركبات، بعد تناول كميات منخفضة من DHA، يحصل الدماغ على DHA يتم تصنيعه من ALA. ثم نوضح أن تناول DHA الغذائي يزيد من مستويات EPA في كبد الفئران ومصلها، وهو ما يعتمد على ALA. علاوة على ذلك، من خلال تحليل النظائر المحددة للمركبات، نثبت أن مصدر زيادة EPA هو تباطؤ في استقلاب EPA، وليس زيادة في تحويل DHA كما كان يُفترض سابقًا. إن تناول DHA بمفرده أو مع ALA يقلل من نشاط إنزيم إطالة السلسلة الطويلة جدًا (ELOVL2، إطالة EPA) في الكبد على الرغم من عدم حدوث تغيير في محتوى البروتين. لتقييم دور ELOVL2 بشكل أكبر، تم إنشاء نموذج حيواني خاص بالكبد (Elovl2 KO) يظهر أن تناول DHA في وجود أو غياب ELOVL2 وظيفي يعطي نتائج مشابهة. تشير تجربة تنافس الإنزيم لإطالة EPA إلى وجود تثبيط غير تنافسي وتنافسي من قبل DHA اعتمادًا على مستويات DHA. لترجمة نتائجنا، نوضح أن مكملات DHA لدى الرجال والنساء تزيد من مستويات EPA بطريقة تعتمد على SNP (rs953413) في جين ELOVL2. في الختام، نحدد مسار تثبيط تغذية جديد حيث يقوم DHA الغذائي بتقليل تخليقه في الكبد عن طريق تثبيط إطالة EPA.

الكلمات الرئيسية التكميلية الدهون الغذائية الحركيات كبد التغذية – أحماض أوميغا-3 الدهنية – تثبيط الإنزيم – الأحماض الدهنية المتعددة غير المشبعة – استقلاب الأحماض الدهنية – إطالة السلاسل الدهنية الطويلة جدًا
يتمتع الدماغ بالأحماض الدهنية غير المشبعة المتعددة (PUFA) أوميغا-3 (n-3) DHA، حيث ينظم إما بشكل مباشر أو بعد تحويله إلى سلسلة من المستقلبات الحيوية النشطة، عدة جوانب مهمة من وظائف الدماغ (1، 2). DHA هو سلف لكل من n-docosahexaenoylethanolamine (synaptamide) والأوكسيليبينات، بما في ذلك الوسائط الدهنية المتخصصة المضادة للالتهابات التي ثبت أنها تؤثر على تطور الأعصاب (3، 4)، الالتهاب (5-7)، وبقاء الخلايا. . يمكن للدماغ الحصول على DHA إما من النظام الغذائي مباشرة أو بعد إزالة التشبع وإطالة سلفه الأساسي من الأحماض الدهنية غير المشبعة 18-carbon، وهو حمض ألفا لينولينيك (ALA، 18:3n-3). بينما تمتلك العديد من الأنسجة القدرة على تصنيع DHA، فإن قدرتها على القيام بذلك تعتبر عمومًا منخفضة، خاصة داخل الدماغ، وتعتمد على تصنيع DHA من الكبد (10-13). ومن المثير للاهتمام أن الكبد، وليس الدماغ، يمكنه زيادة تصنيع DHA استجابةً لانخفاض DHA في النظام الغذائي، على الرغم من أن الآلية غير معروفة (14، 15). علاوة على ذلك، منذ عام 1985 (16)، لوحظ أن مكملات DHA تزيد بشكل واسع من مستويات EPA في البشر (16-24) والقوارض (25-32)، وكان يُعتقد أن هذه الاستجابة هي نتيجة لزيادة التدفق من خلال مسار التحويل العكسي الذي تم اكتشافه في عام 1969 (33) والذي يتضمن جزئيًا أكسدة DHA في البيروكسيزومات لتكوين EPA.
تحليل النظائر المحددة للمركبات (CSIA) قد برز كأداة قيمة للتحقيق في التغذية والتمثيل الغذائي وقد تم مراجعته مؤخرًا (34). باختصار، وفرة ) في النباتات يختلف بشكل طبيعي اعتمادًا على المسارات التمثيلية الضوئية الموجودة، حيث تتمتع النباتات ذات التمثيل الضوئي من النوع C4 (مثل قصب السكر والذرة) بمستويات أعلى من قيم أقل من النباتات التي تقوم بعملية التمثيل الضوئي من النوع C3 (مثل الكتان وزيت الكانولا)، مع
تشكل هذه الاختلافات الطبيعية الغالبية العظمى من جميع أنواع النباتات (35). هذه الاختلافات الطبيعية في المغذيات – بما في ذلك الأحماض الدهنية – من النباتات وأنسجة الحيوانات التي تستهلكها هي ما يمكّن دراسات التغذية والتمثيل الغذائي المدفوعة بـ CSI عبر قياس الكتلة النسبية لل isotopes بواسطة GC-combustion (CIRMS) بدقة عالية. باستخدام CSIA، أظهرنا مؤخرًا أن الآليات المقبولة سابقًا التي تفسر زيادة EPA مع مكملات DHA كانت غير دقيقة (24). على وجه التحديد، تم تزويد البالغين الشباب بمكملات يوم يحتوي على DHA عالي مستويات C-DHA 0.2 ، ملي يوري (mUr) SEM) بالنسبة لمستويات البلازما المنخفضة المستويات في المشاركين. كما هو متوقع، زادت مكملات DHA من تركيزات EPA في البلازما بـ أكثر من 12 أسبوعًا؛ ومع ذلك، لم تتغير المستويات عن خط الأساس ( ) لنشر المكملات ( ) مما يشير إلى أن ALA، مع مستوى بلازما أساسي -ALA من ، كان يساهم في زيادة DHA. وقد دعمت هذه الدراسة الانتقالية دراسة سابقة حيث أظهرت جرذان لونغ-إيفانز التي تم تغذيتها إما بنظام غذائي يحتوي على ALA + DHA أو نظام غذائي يحتوي على ALA فقط لمدة 8 أسابيع عدم وجود اختلافات في الكبد القيم ( و ، على التوالي) على الرغم من الارتفاع الكبير في قيم DHA في النظام الغذائي لـ .
بشكل جماعي، تشير هذه النتيجة الجديدة إلى أن ALA هو مصدر أيضي لزيادة EPA في بلازما الإنسان وكبد الجرذ بعد تناول DHA، مما يقترح تباطؤ في أيض EPA. في هذه الدراسة، نهدف إلى تحديد ما إذا كان الآلية وراء تباطؤ أيض EPA تعمل على تنظيم DHA في الدماغ من خلال تثبيط تخليق DHA في الكبد. في الدراسة الحالية، نحن (1) نجد أنه استجابةً لتغذية منخفضة DHA، يتلقى الدماغ DHA المُصنّع من ALA، (2) نقدم ALA، DHA، أو ALA + DHA إلى الفئران البرية (BALB/c)، بالإضافة إلى الفئران الضابطة، وفئران KO الخاصة بالكبد التي تعاني من إطالة السلسلة الطويلة جداً 2 (Elovl2) (C57Bl/6J)، لإظهار أن DHA المدمج مع ALA مطلوب لزيادة EPA بطريقة تشير إلى تثبيط ELOVL2، (3) نستخدم اختبار تنافس الإنزيم لإظهار التثبيط غير التنافسي وغير التنافسي بواسطة DHA على إطالة EPA، و (4) نقوم بإجراء تحليل ثانوي على بلازما الإنسان من الرجال والنساء الذين تناولوا مكملات DHA لتحديد SNP في الذي يؤدي إلى زيادة أكبر في مستويات EPA بعد مكملات DHA. بشكل جماعي، تحدد هذه الدراسة أن إطالة EPA في الكبد يتم تنظيمها سلبًا بواسطة DHA الغذائي لمنع تخليق DHA.

المواد والأساليب

بيان الأخلاقيات

تم تنفيذ جميع بروتوكولات وإجراءات الحيوانات بما يتماشى مع سياسات المجلس الكندي لرعاية الحيوانات وتمت الموافقة عليها من قبل لجنة أخلاقيات الحيوانات بجامعة تورونتو. تمت الموافقة على التجربة السريرية العشوائية على البشر من قبل مجلس أخلاقيات البحث البشري في جامعة غويلف، وتلتزم بإعلان
مبادئ هلسنكي وتم تسجيلها فيclinicaltrials.gov (NCT03378232).

تصميم الدراسة

دراسة تغذية الفئران. تم طلب أربعة وعشرون فأرًا من نوع BALB/c بعمر 28 يومًا من مختبرات تشارلز ريفر (سان كونستانس، كيو سي) وتم وضعها على ALA في نظام غذائي عالي الدهون (ALA) لمدة 4 أسابيع. بعد هذه الأسابيع الأربعة الأولى من تغذية ALA، تم وضع الفئران على أحد الأنظمة الغذائية الثلاثة لمدة 4 أسابيع إضافية: (1) الاستمرار على حمية ALA، (2) تم التحول إلى حمض الدوكوساهيكسانويك في إجمالي الدهون (حمض الدوكوساهيكسانويك) النظام الغذائي، أو (3) تم التحويل إلى ألا DHA في إجمالي الدهون (ALA + DHA) النظام الغذائي. تم تعديل جميع الأنظمة الغذائية من أنظمة AIN-93G المخصصة المنخفضة في الأحماض الدهنية غير المشبعة n-3 (Dyets, Inc، بيت لحم، بنسلفانيا) المستخدمة سابقًا (31، 36-38). كانت الأنظمة الغذائية تحتوي على الدهون حسب الوزن تتكون من زيت القرطم زيت جوز الهند المهدرج، و زيوت مضافة (تركيبة من ALA وDHA وإسترات الإيثيل الأولي) تم شراؤها من شركة Nu-Chek Prep, Inc (إيليسيان، مينيسوتا). الـ ALA الفردية تحتوي أنظمة غذائية DHA أيضًا على إستر الإيثيل أوليات لتحقيق التوازن مع الأحماض الدهنية المتعددة غير المشبعة n-3 الإضافية الموجودة في نظام غذائي يحتوي على ALA + DHA.
تم تحديد تركيبات الأحماض الدهنية في النظام الغذائي بواسطة الكشف عن اللهب بالكروماتوغرافيا الغازية (FID) لتحتوي على ألا (حمية ألا فقط) DHA في نظام الحمية الذي يحتوي على DHA فقط، و 0.01 ALA و DHA في نظام غذائي يحتوي على ALA + DHA. علاوة على ذلك، تم تحديد القيم بواسطة GC-C-IRMS على أنها لـ ALA، لـ DHA، و لـ ALA و لـ DHA في حمية ALA، DHA و ALA + DHA، على التوالي (انظر الجدول التكميلي Sl لتركيب الأحماض الدهنية الكامل). عند 12 أسبوعًا من العمر وبعد فترة التغذية التي استمرت 8 أسابيع، تم تخدير الفئران تحت تأثير الإيزوفلوران، وتم جمع الدم عن طريق ثقب القلب، وتم غسل الحيوانات بماء بارد. محلول ملحي معزز بالفوسفات إلى البطين الأيسر. تم جمع المصل والكبد وتم تجميدهما على الفور على الثلج الجاف قبل التخزين في قبل تحديد مستويات الأحماض الدهنية، تعبير الجينات، محتوى البروتين ونشاط الإنزيمات.
دراسة تغذية الفئران المعدلة وراثيًا Elovl2 KO الخاصة بالكبد. تم استلام ستة فئران من نوع C57Bl/6J (ذكرين وأربعة إناث) من جامعة باريس سيتé. كانت جميع الفئران تحمل جين Elovl2 بشكل floxed (lox/lox)، حيث كان الذكور يعبرون عن Cre (+/-) في الكبد تحت محفز الألبومين، بينما الإناث لم يكن لديهن تعبير عن Cre (-/-). تم تأكيد خصوصية Elovl2 KO في الكبد من خلال التعبير الجيني قبل الشحن مقارنة بتعبير Elovl2 في الكلى. عند وصولهم إلى جامعة تورونتو، تم حجر الفئران لمدة تقارب أسبوعين ثم تم تربية الحريم (ذكر واحد واثنتان من الإناث لكل حريم). عند الفطام (21 يومًا)، تم تحديد الجينات للجراء من أجل Cre وعند بلوغهم 28 يومًا تم وضع الجراء في نفس بروتوكول التغذية لمدة 8 أسابيع الموصوف لدراسة تغذية فئران BALB/c. بعد 8 أسابيع من التغذية، تم ضخ الفئران الذكور، وجمع السيروم، والأدمغة، والأكباد وتخزينها كما هو موضح أعلاه لفئران BALB/c. تم وضع الفئران من نفس الولادات في مجموعات غذائية مختلفة حسب النمط الجيني مع فئران سلبية لـ تم تضمينه كمجموعة التحكم.
دراسة تنافس الإنزيم. تم طلب ذكور فئران BALB/c بعمر ثمانية أسابيع من مختبرات تشارلز ريفر وتم وضعها على نظام غذائي قياسي من طعام تيكلاد 2918 (إنفيغو، إنديانابوليس، إنديانا) لمدة 6 أسابيع. كما تم الإبلاغ سابقًا، كانت تركيبة الأحماض الدهنية في النظام الغذائي، كنسبة مئوية من الوزن في إجمالي الأحماض الدهنية، 6.2% ALA، ، و (39). بعد 6 أسابيع، تم ضخ الفئران التي تبلغ من العمر 12 أسبوعًا بمحلول بارد-
تم جمع المحاليل المالحة والكبد كما هو موضح أعلاه لتحليل نشاط إنزيمات الكبد في تحويل EPA إلى حمض الدوكوسابنتاينويك n-3 (DPAn-3، 22:5n-3) (ELOVL2/5).
دراسة مكملات DHA البشرية. عينات بلازما بشرية من الذكور والإناث و 14، على التوالي) من تجربة عشوائية محكمة تم نشرها سابقًا تم استخدامها لتقييم دور rs953413 (ELOVL2) و rs174537 ديساتوراز الأحماض الدهنية 1 (FADS1) SNP في التغيرات في مستويات EPA بعد 12 أسبوعًا من المكملات مع يوم من ثلاثي غليسريد DHA المستمد من زيت السمك نقاء). كانت كميات صغيرة من الشوائب من الأحماض الدهنية غير المشبعة n-3 موجودة في شكل ألا وكالة حماية البيئة، و DPAn-3، بينما كانت جميع الشوائب الأخرى مشبعة ( ) ، أحادية غير مشبعة ( ) أو حمض اللينوليك ( ) (24). تم الإبلاغ عن المعلومات المنهجية ومعلومات المشاركين بالتفصيل سابقًا .

تحليلات الأحماض الدهنية

استخراج الدهون وتحضير استرات الميثيل للأحماض الدهنية. تم استخراج الدهون من من بلازما الإنسان، من مصل الفأر، و50 ملغ من دماغ الفأر وكبده في كلوروفورم: ميثانول بطريقة فولش المعدلة (41). تم تضمين إستر حمض الدوكوساتراينويك (22:3n-3) الإيثيلي (Nu-Chek Prep) بتركيز 10,5، و ، على التوالي، كمعيار داخلي لتحديد كمية الأحماض الدهنية. بعد التماثل، تم فصل الطور الدهني والطور المائي بإضافة ، تم الطرد المركزي عند لمدة 5 دقائق، وتم عزل المرحلة المحتوية على الدهون في الكلوروفورم. تم تجفيف مستخلصات الدهون الكلية الناتجة من البلازما/المصل وكمية من مستخلصات الدهون الكلية من الكبد تحت تيار من النيتروجين وتم تحويلها إلى استرات. بورون ثلاثي فلوريد في الميثانول لمدة ساعة واحدة عند تم تبريد العينات إلى درجة حرارة الغرفة، ثم أضيف 1 مل من الماء والهكسان، وتم خلطها باستخدام جهاز الخلط، ثم تم الطرد المركزي. لمدة 5 دقائق. تم عزل طبقة الهكسان العلوية التي تحتوي على استرات الميثيل للأحماض الدهنية (FAMEs)، وتجفيفها تحت النيتروجين، وإعادة تعليقها في 100-200 الهبتان، الذي تم تحليله بواسطة GC-FID، ثم تم إعادة تغطيته، وتم تحليله لاحقًا بواسطة GC-C-IRMS.
الكروماتوغرافيا الغازية. تم تحليل الأحماض الدهنية الميثيلية الناتجة من بلازما الإنسان باستخدام جهاز Varian 430 GC-FID (SCION Instruments، غوس، هولندا) المزود بعمود SP-2560. الهوية عمود شعري بسماكة فيلم (MilliporeSigma، برلنغتون، ماساتشوستس)، كما تم وصفه سابقًا (24، 37). تم تحليل الأحماض الدهنية الميثيلية الناتجة من مصل الفأر والدماغ والكبد على نفس جهاز GC-FID، المجهز بدلاً من ذلك بـ DB-FFAP. هوية عمود شعري بسماكة فيلم (J&W Scientific من Agilent Technologies، ميسيساغا، أونتاريو). FAMEs ( تم إدخالها إلى جهاز GC-FID بواسطة جهاز أخذ عينات أوتوماتيكي Varian CP-8400 إلى المحقن المسخن عند مع نسبة تقسيم قدرها كانت درجة حرارة الفرن الأولية مع فترة انتظار مدتها 1.0 دقيقة تليها منحدر إلى ، منحدر إلى ، منحدر إلى مع فترة انتظار مدتها 9.5 دقيقة، ثم زيادة إلى مع فترة احتفاظ مدتها 11.1 دقيقة في النهاية. كانت درجة حرارة FID مع معدلات تدفق غاز التجميل من الهواء والهيليوم تبلغ 300 و على التوالي، وتردد عينة قدره 40 هرتز. تم تحديد القمم من خلال أوقات الاحتفاظ من خلال المقارنة مع عينة معيارية مختلطة خارجية (GLC-462، Nu-Chek Prep).
تم تحليل FAMEs المستخرجة من مصل الفئران والدماغ والكبد لمحتوى الكربون-13. ) على جهاز Thermo MAT253 C-IRMS (ثيرمو فيشر العلمية، بريمن، ألمانيا)، تم حقنه بواسطة جهاز TriPlus RSH الأوتوماتيكي على عمود كابيلاري SP-2560 مثبت على جهاز Trace 1310 GC. تدخل الأحماض الدهنية إلى مفاعل الاحتراق ويتم احتراقها كميًا إلى ،
الذي يدخل إلى جهاز MAT253 IRMS عبر واجهة تدفق مستمر ConFlo IV التي توفر من ، وبالتالي شهرة الاهتمام. جميع التفاصيل المنهجية الإضافية ذات الصلة بـ تحليل، مثل التحليل، والتقارير عن القيم، التطبيع النظائري، وتصحيحات مجموعة الميثيل كما تم وصفها سابقًا بالتفصيل .

تحليلات الجينات والإنزيمات

تحديد النمط الجيني لفأر Elovl2 KO المحدد للكبد. تم استخراج الحمض النووي من عينات الأذن المجمعة من الفئران التي تم فطامها في عمر 21 يومًا باستخدام مجموعة REDExtract-N-Amp Tissue PCR (MilliporeSigma). باختصار، محلول الاستخراج و تم إضافة محلول تحضير الأنسجة إلى عينات الأذن، وتم خلطه باستخدام جهاز الخلط، ثم تم حضنه في درجة حرارة الغرفة لمدة 10 دقائق، و لمدة 3 دقائق. تمت إزالة العينات من الحرارة، تم إضافة محلول التعادل على الفور وتم خلطه. ثم تم تخزين مستخلصات الحمض النووي في حتى يتم إجراء تحليل إضافي. تم تضخيم الحمض النووي باستخدام مجموعة إنزيم Taq DNA Polymerase السريعة (روش دياغنوستكس، ميسيساوجا، أونتاريو). باختصار، كانت كل عينة/خليط من المواد الكيميائية للتضخيم تشمل ماء محلول تفاعل PCR مع ، خليط نوكليوتيدات dNTP بلميراز الحمض النووي Taq كل من جات جي سي أيه أيه سي آتي إيه سي جي سي إيه إيه جي جي، آر-5′ سي سي سي تي جي إيه أيه سي آتي جي تي سي سي آتي سي إيه جي جي) -أكتين (F-5′ GCCTCAT GCCATTCTACGAC، R-5′ CGAATACTTGCGTTCTGGGG) البادئات الأمامية والخلفية، و لمادة الحمض النووي المستخرج. باستخدام نظام بيوميتر المحترف للتدرج (مونتريال بيوتيك إنك، كيركلاند، كيو سي)، تم بعد ذلك حضن خلطات تفاعل البوليميراز المتسلسل في لمدة 4 دقائق، تليها 40 دورة من لـ لمدة 0.5 دقيقة ، و لمدة 1.0 دقيقة، مع تثبيت نهائي عند لمدة 7 دقائق لتكبير الـ Cre و -جينات الهدف والضبط الإيجابي لـ -أكتين، على التوالي. إلى كل مزيج، تم إضافة صبغة الفلورسنت Safe-Green (Abcam، كامبريدج، المملكة المتحدة) وخلطها، و تمت إضافته إلى تم إعداد آبار هلام الأجاروز وتشغيلها بواسطة الرحلان الكهربائي للهلام لمدة 45 دقيقة عند 100 فولت. تم تصور هلام الأجاروز تحت ضوء الأشعة فوق البنفسجية لـ Cre (386 نقطة أساسية) و -أكتين (502 نقطة أساسية) الأشرطة بالنسبة لـ سلم الحمض النووي المرجعي bp (FroggaBio، كونكورد، أونتاريو) (الشكل التكميلي S1).
تحديد الجينات البشرية. تم استخراج الحمض النووي من الدم الكامل باستخدام مجموعة Qiagen PAXgene Blood DNA (Qiagen، تورونتو، أونتاريو) وتم إجراء تحديد الجينات باستخدام منصة Sequenom MassArray، كما تم وصفه سابقًا (42، 43). تم تحديد الأنماط الجينية لـ SNP rs953413 (ELOVL2) و rs174537 (FADS1) لجميع المشاركين. تم اختبار الانحرافات عن توازن هاردي-واينبرغ لكل SNP لجميع المشاركين وداخل مجموعات الذكور والإناث باستخدام اختبار كاي-تربيع. كما تم الإبلاغ سابقًا (42)، تم اختيار خمس عينات عشوائيًا للتكرار مع تم تحقيق التوافق.
تعبير الجينات في الكبد وكتل البروتين لفئران BALB/c. تم استخراج RNA الكلي باستخدام مادة TRIzol (Invitrogen، ماساتشوستس، الولايات المتحدة الأمريكية) لتفتيت الأنسجة ومجموعة RNeasy Mini (Qiagen، ميسيساغا، أونتاريو، كندا)، وفقًا لتعليمات الشركة المصنعة. تم تحديد تركيز RNA ونقائه باستخدام جهاز NanoDrop. مقياس الطيف الضوئي (ثيرمو فيشر ساينتيفيك، ويلمنغتون، الولايات المتحدة الأمريكية). فقط العينات التي تحتوي على تركيز كافٍ من RNA ونسب نقاء و بين 1.8 و 2.2 تم استخدامها لتحليل تعبير الجينات. تم استخدام ميكروغرام واحد من RNA الكلي لتخليق cDNA باستخدام أجهزة Applied Biosystems مجموعة النسخ العكسية cDNA عالية السعة (ثيرمو فيشر ساينتيفيك)، وفقًا لـ
تعليمات الشركة المصنعة. تم إجراء النسخ العكسي PCR الكمي (RT-qPCR) على نظام Bio-Rad CFX96 للوقت الحقيقي. تم تصميم البرايمرات المستخدمة في RT-qPCR عبر الإنترنت باستخدام مكتبة بروب العالمية من روش ومركز تصميم الاختبارات. إجمالي حجم التفاعل لكل عينة ( ) تم صنعه، يتكون من سسو فاست إيفاغرين سوبر ميكس (مختبرات بيو راد) قالب cDNA من خليط من بادئات الأمام والخلف، و ماء خالٍ من النوكلياز. تم استخدام ظروف الدورة التالية: دورة واحدة للتفكيك في لمدة 30 ثانية، تليها 40 دورة من لمدة 4 ثواني و لمدة 4 ثوانٍ. تم إجراء جميع التفاعلات ثلاث مرات. بعد ذلك، تم استخدام 18S كجين مرجعي للتطبيع. تم قياس النتائج باستخدام طريقة.
كتل البروتين ( تم تحديد مستويات إنزيمات FADS2 و FADS1 و ELOVL2 و ELOVL5 باستخدام مجموعات اختبار المناعة المرتبطة بالإنزيمات المتاحة تجارياً (MyBioSource, Inc، سان دييغو، كاليفورنيا، الولايات المتحدة الأمريكية) وفقًا لتعليمات الشركة المصنعة. باختصار، تم إضافة من مستحلب الكبد المخفف إلى آبار العينة، ثم تم إغلاق الألواح واحتضانها في لمدة 90 دقيقة. ثم تم غسل الأطباق، وأضيفت الأجسام المضادة المعلّمة بالبيوتين إلى الآبار، وتمت الحضانة عند لمدة 60 دقيقة ثم تم الغسل. بعد ذلك تم إضافة مركب HRP-streptavidin، وتمت عملية الحضانة والغسل. ثم تم إضافة ركيزة 3,3′,5,5′-tetramethylbenzidine، وتمت عملية الحضانة عند لـ توقفت التفاعل، وتم قراءة الامتصاص عند 450 نانومتر ومقارنته بمنحنى قياسي.
أنشطة إنزيمات الكبد فئران. كبد محقون من دراسة تغذية فئران BALB/c مجمد على الثلج الجاف ( تم تجانسها في محلول عازل pH 7.9 يحتوي على هيبس EDTA نونيديت P-40 ومثبطات البروتياز ( فلوريد الفينيل ميثيل سلفونيل أبروتين ليوببتين، و أورثوفانادات). تم طرد مستخلصات الكبد في جهاز الطرد المركزي عند ، أولاً في لمدة 30 ثانية، تليها الطرد المركزي للسوائل الطافية عند لمدة 5 دقائق، وأخيرًا في لمدة 60 دقيقة، للحصول على الكسور الميكروسومية لتقييم أنشطة الديساتوراز والإيلونغاز.
تم تقييم أنشطة الديساتوراز والإيلونغاز باستخدام 1 مل من وسط الحضانة يحتوي على ATP مساعد الإنزيم أ NADPH، -أسيتيل سيستين، نيكوتيناميد ، و محلول عازل فوسفات pH 7، مضاف إليه 100 نانومول من سلف الن-3 PUFA المرتبط بالألبومين و1 ملغ من بروتين المستخلص السيتوزولي إلى حجم المزيج النهائي للتفاعل البالغ 2 مل، تم حضنه عند لمدة 30 دقيقة مع الاهتزاز. تمثل كل تفاعل ما يعادل بين 60 و 80 ملغ من نسيج الكبد. عند تحديد نشاط الإيلونغاز، تم تضمين 5 مليمول من مالونيل-CoA في خليط التفاعل. تم تحديد نشاط إنزيم FADS2 من خلال كمية 18:3n-3 (ALA) المحولة إلى (SDA)، نشاط FADS1 حسب كمية (ETA) تم تحويله إلى نشاط ELOVL2 بواسطة كمية 22:5n-3 (DPAn-3) المحولة إلى (حمض التتراكوبيتاينويك n-3)، نشاط ELOVL5 من خلال كمية 18:4n-3 المحولة إلى 20:4n-3 (ETA)، ونشاط ELOVL2/5 من خلال كمية تحول إلى (٤٤).
تم إيقاف كل تفاعل محدد عن طريق إضافة 6 مل من خليط الكلوروفورم:الميثانول ( حمض الهيبتاديسيك (17:0؛ نقاء ) تم إضافة ( ) كمعيار داخلي. لتحديد مستويات المنتجات أو السلف التي تم تحقيقها بعد الحضانة، تم استخراج الدهون وتحويلها إلى FAME وتحديد المستويات بواسطة GC-FID، كما هو موضح سابقًا. من نتائج GC-FID، تم قياس أنشطة إنزيمات الديساتوراز والإيلونغاز.
تم قياسها كزيادة صافية في منتج الأحماض الدهنية غير المشبعة من النوع n-3 الناتج من سلفه n-3 PUFA، محسوبة من الفروق بين القيم الأساسية قبل الحضانة وتلك التي تم الحصول عليها بعد 30 دقيقة من الحضانة. يتم التعبير عن النتائج كـ بروتين (45).
اختبار تنافس الإنزيم بواسطة DHA لتحويل EPA إلى DPAn-3 بواسطة ELOVL2/5. لتحديد تأثير DHA على نشاط تفاعل ELOVL2/5. التحويل إلى قمنا بإجراء نفس عملية العزل الميكروسومي وتفاعل نشاط الإنزيم الموصوف سابقًا في الفئران لدراسة تنافس الإنزيم. تم إعداد اختبارات تنافس الإنزيم باستخدام DHA كمانع بتركيزات مختلفة. ، و ) في وجود EPA، سلف تفاعل الإيلونغاز، بتركيزات مختلفة ( 0، 50، 100، 150، و تم تحديد تركيزات منتج ELOVL2/5 (22:5n-3) نتيجة التفاعل على أنها البروتين واستخدم لتوليد منحنيات مايكلس-مينتن. لتقييم تأثير DHA مقارنة بحمض دهني ضابط، تم مقارنة حمض البالمتيك (16:0) وDHA كمثبطات لـ ELOVL2/5 عند تركيزات متزايدة من كلا الحمضين الدهنيين. ، و ) في حضور وكالة حماية البيئة
تحليلات إحصائية. تم إجراء اختبارات ANOVA واختبارات توكي اللاحقة باستخدام برنامج IBM Statistics 24 (IBM، أرمونك، نيويورك،https://www.ibm.com/products/spssstatistics“). تم تحويل البيانات التي لم تتوزع بشكل طبيعي كما حددها اختبار شابيرو-ويلك إلى لوغاريتم قبل تحليل ANOVA. تم تطوير منحنيات ميكاليز-مينتن لاختبار تنافس الإنزيم باستخدام برنامج GraphPad Prism 9.1 (GraphPad Software، سان دييغو، كاليفورنيا،https://www.graphpad. com/). تم تحديد الأهمية لجميع التحليلات الإحصائية عند جميع البيانات مقدمة كمتوسطات SEM.

النتائج

تركيزات DHA في الدماغ و مستويات من الفئران الضابطة التي تناولت حميات ALA وDHA أو ALA + DHA

من أجل اختبار كيفية حصول الدماغ على DHA عندما يكون DHA غائبًا أو حاضرًا في النظام الغذائي، خضعت الفئران المعدلة وراثيًا Elovl2 KO لمدّة 4 أسابيع من التغذية على نظام غذائي يحتوي فقط على ALA، تلتها 4 أسابيع إضافية من التغذية على نظام غذائي يحتوي فقط على ALA، ونظام غذائي يحتوي فقط على DHA، ونظام غذائي يحتوي على ALA + DHA. لم تسفر تحليل توكي بعد التجربة عن أي اختلافات ذات دلالة إحصائية. ) في تركيزات DHA في الدماغ و ، على التوالي) بعد تحليل التباين الأحادي ذي الاتجاه الواحد (ANOVA) ذو دلالة إحصائية ) (الشكل 1A). ومع ذلك، الدماغ كانت مستويات -DHA مختلفة بشكل ملحوظ بين جميع المجموعات التي تحتوي على DHA فقط ALA + DHA أنظمة غذائية تعتمد فقط على ALA (الشكل 1B).

تركيزات الأحماض الدهنية غير المشبعة المتعددة n-3 في المصل والكبد لفئران BALB/c التي تم تغذيتها بـ ALA أو DHA أو ALA + DHA

بعد 4 أسابيع من تغذية فئران BALB/c بنظام غذائي يحتوي فقط على ALA، ثم الحفاظ على الحيوانات على نظام ALA الغذائي أو التحويل إلى نظام غذائي يحتوي فقط على DHA أو نظام ALA + DHA لمدة 4 أسابيع أخرى، تم ضخ الحيوانات.
الشكل 1. تركيزات DHA في الدماغ (A) ومستويات الكربون-13 (B) ) من الفئران الضابطة التي تم تغذيتها بنظام غذائي يحتوي على ALA فقط، DHA فقط و ALA + DHA. تم تحديد طبيعة التوزيع باستخدام اختبار شابيرو-ويلك، وتم تحويل البيانات غير الطبيعية إلى لوغاريتمات قبل إجراء المزيد من التحليل الإحصائي. تمثل الحروف المختلفة (أ، ب، وج) اختلافات ذات دلالة إحصائية ( بين الحميات وتم تحديدها بواسطة تحليل التباين الأحادي (ANOVA) تليه اختبار توكي HSD بعد الاختبار. جميع القيم مُبلغ عنها كمتوسطات SEM ). وفرة الكربون-13؛ ؛ ألانين، -حمض اللينولينيك، 18:3n-3؛ DHA، حمض الدوكوساهيكسانويك، 22:6n-3؛ HSD، فرق ذو دلالة إحصائية.
ومستويات الأحماض الدهنية غير المشبعة من النوع n-3 (الشكل 2A) في المصل (الشكل 2B) والكبد تم تحديدها. في كلا النسيجين، كانت مستويات ALA أعلى ) في الفئران التي تم تغذيتها بالنظامين الغذائيين المحتويين على ALA مقارنة بالنظام الغذائي الذي يحتوي فقط على DHA والذي كان خالياً من ALA. وبالمثل، كانت مستويات DHA في كلا النسيجين أعلى ) في النظامين الغذائيين المحتويين على DHA مقارنة بالنظام الغذائي الذي يحتوي فقط على ALA خالٍ من DHA. والأهم من ذلك، كانت مستويات EPA أعلى ( في المصل SEM وكبد الفئران التي تم تغذيتها بنظام ALA + DHA مقارنة بتلك التي تم تغذيتها بـ ALA فقط (24.5 و ، على التوالي) ونظام غذائي يحتوي على DHA فقط و على التوالي)، مما يشير إلى أن كلاً من ALA و DHA ضروريان لزيادة EPA.

محتوى الكربون-13 من الأحماض الدهنية غير المشبعة n-3 في المصل والكبد لدى فئران BALB/c التي تم تغذيتها بـ ALA أو DHA أو ALA + DHA

بالإضافة إلى تركيزات الأحماض الدهنية في المصل في فئران BALB/c (الشكل 2)، من ALA و EPA و DHA
الشكل 2. تركيزات N-3 PUFA في ذكور فئران BALB/c التي تم تغذيتها لمدة 4 أسابيع بـ: (1) ALA فقط (ALA)، (2) DHA فقط (DHA) أو (3) حمية ALA + DHA بعد حمية ALA لمدة 4 أسابيع. A: المصل و (B) الكبد. تم تحديد الطبيعية بواسطة اختبار شابيرو-ويلك للنمط الطبيعي وتم تحويل البيانات غير الطبيعية لوغاريتمياً قبل إجراء التحليل الإحصائي الإضافي. تمثل الحروف المختلفة (أ، ب، وج) اختلافات ذات دلالة إحصائية. بين الحميات لحمض دهني محدد وتم تحديدها بواسطة تحليل التباين الأحادي (ANOVA) تلاه اختبار توكي HSD بعد الاختبار. جميع القيم مُبلغ عنها كمتوسطات. SEM ). ألا، -حمض اللينولينيك، 18:3n-3؛ DHA، حمض الدوكوساهيكسانويك، 22:6n-3؛ DPAn-3، حمض الدوكوسابنتاينويك n-3، 22:5n-3؛ EPA، حمض الإيكوسابنتاينويك، 20:5n-3؛ HSD، الفرق ذو الدلالة الإحصائية.
تم تحديد مستوياتها في المصل (الشكل 3A-C) والكبد (الشكل 3D-F) لتحديد مصادر كل منها، سواء كانت ناتجة عن تخليق ALA أو من DHA المُشكلة مسبقًا. مستويات ALA (mUr SEM) في المصل لم تكن مختلفة بين الـ ALA و ALA + DHA ( الفئران التي تم إطعامها، مع كل من الأدنى من الفئران التي تم إطعامها DHA فقط 0.7 مUr). الكبد -ALA كان مختلفًا ( ) بين جميع مجموعات الحمية الثلاث حيث DHA ( المستويات بين الفئران التي تغذت على ALA و ALA + DHA في كل من المصل ( و ، على التوالي) والكبد ( 1.6 و على التوالي) لم تكن مختلفة ( ). ومع ذلك، كان أعلى بشكل ملحوظ في المصل
الشكل 3. مستويات الكربون-13 لـ ALA و EPA و DHA ) من ذكور فئران BALB/c التي تم تغذيتها لمدة 4 أسابيع بـ (1) ALA فقط (ALA)، (2) DHA فقط (DHA) أو (3) حمية ALA + DHA بعد حمية ALA لمدة 4 أسابيع. A: ALA في المصل، (B) EPA في المصل، (C) DHA في المصل، (D) ALA في الكبد، (E) EPA في الكبد، و (F) DHA في الكبد. تم تحديد الطبيعية بواسطة اختبار شابيرو-ويلك للطبيعية وتم تحويل البيانات غير الطبيعية إلى لوغاريتم قبل إجراء المزيد من التحليل الإحصائي. تمثل الحروف المختلفة (a، b، و c) اختلافات ذات دلالة إحصائية ( بين الحميات وتم تحديدها بواسطة تحليل التباين الأحادي (ANOVA) تليه اختبار توكي HSD بعد الاختبار. جميع القيم مُبلغ عنها كمتوسطات SEM ). وفرة الكربون-13؛ يعني أنظمة ALA و ALA + DHA؛ (mUr) من حميات DHA و ALA+DHA؛ ALA، -حمض اللينولينيك، 18:3n-3؛ DHA، حمض الدوكوساهيكسانويك، 22:6n-3؛ EPA، حمض الإيكوسابنتاينويك، 20:5n-3؛ HSD، الفرق ذو الدلالة الإحصائية.
وكبد ( ) لمجموعة DHA فقط مقارنة بأي مجموعة تغذت على ALA، مما يكشف أن DHA يصبح مصدرًا مهمًا لـ EPA فقط في غياب ALA. وقد أظهرت نتائج مماثلة أيضًا لـ C-DPAn-3 (الشكل التكميلي S2). المصل كانت مستويات -DHA مختلفة بشكل ملحوظ بين جميع الحميات (DHA ALA + DHA ألا و ، على التوالي)، وكبد -DHA بعد DHA ( ) و ALA + DHA كانت التغذية أعلى بشكل ملحوظ ( ) من اتباع تغذية ALA ( ).

تعبير الجينات في الكبد، محتوى البروتين، ونشاط الإنزيمات في فئران BALB/c التي تم تغذيتها بأنظمة غذائية تحتوي على ALA، DHA، أو ALA + DHA

تم قياس تعبير mRNA ومستويات البروتين ونشاط الإنزيم (الشكل 4A-C) في كبد الفئران التي تم تغذيتها بـ ALA أو DHA أو ALA + DHA. كان mRNA الخاص بـ Elovl2 أقل في مجموعة DHA مقارنة بمجموعة ALA )، وكان Elovl5 أقل في مجموعة DHA مقارنة بمجموعة ALA ) (الشكل 4A). لم يكن تعبير Elovl2 و Elovl5 في مجموعة ALA + DHA مختلفًا عن الفئران التي تغذت على ALA أو DHA ( ). علاوة على ذلك، كانت مستويات mRNA لـ Fads 2 أقل في DHA و أقل في مجموعة ALA + DHA مقارنة بمجموعة ALA لم تكن هناك اختلافات في تعبير mRNA لأي جين عند مقارنة الفئران التي تغذت على DHA والفئران التي تغذت على ALA + DHA. لم يتم الكشف عن أي اختلافات في mRNA الخاص بـ Fads1 بين المجموعات الثلاث.
تغذية DHA فقط و ALA + DHA أدت إلى انخفاض فادس2 و SEM، على التوالي) و FADS1 ( و محتوى البروتين مقارنة بـ FADS2 ) و FADS1 ( ) مستويات في ALA فقط الحيوانات التي تم تغذيتها. لم يختلف محتوى البروتين في ELOVL2 و ELOVL5 ( ) بين أي مجموعات غذائية (الشكل 4B).
نشاط إنزيمات الكبد بروتين تم قياس (SEM) في الميكروسومات الكبدية المعزولة وتحديده من خلال معدل تحويل سلف خارجي مزود إلى منتجه (الشكل 4C). بالمقارنة مع الحيوانات التي تم تغذيتها فقط بـ ALA لـ FADS2، 0.077 لـ FADS1 و لـ ELOVL2) كانت نشاط الإنزيم أقل لـ FADS2 ( و ), FADS1 ( و )، و ELOVL2 ( و ) لكل من الفئران التي تغذت على DHA فقط والفئران التي تغذت على ALA + DHA، على التوالي. لا توجد اختلافات ( ) تم تحديد اختلافات في نشاط الإنزيم بين البروتوكولات الغذائية لـ ELOVL5 أو تفاعل ELOVL2/5 (EPA دي بي إيه إن-3).

مستويات السيروم والأحماض الدهنية غير المشبعة من النوع n-3 في الكبد لدى فئران Elovl2 KO المحددة للكبد التي تم تغذيتها بأنظمة غذائية تحتوي على ALA أو DHA أو ALA + DHA

مماثل لدراسة التغذية في فئران BALB/c، بعد 4 أسابيع من تغذية فئران Elovl2 KO المحددة للكبد ونظيراتها من الفئران الضابطة على نظام غذائي يحتوي فقط على ALA، ثم الحفاظ على الحيوانات على نظام ALA الغذائي أو التحويل إلى نظام غذائي يحتوي فقط على DHA أو نظام ALA + DHA لمدة 4 أسابيع أخرى، تم euthanized الحيوانات، وتم تحديد مستويات الأحماض الدهنية في المصل (الشكل 5A) والكبد (الشكل 5B). كان هناك تأثير تفاعلي ذو دلالة إحصائية (النوع الجيني تمت ملاحظته لـ
الشكل 4. تعبير الجينات في الكبد، محتوى البروتين، ونشاط الإنزيمات في ذكور فئران BALB/c التي تم تغذيتها لمدة 4 أسابيع بـ (1) ALA فقط (ALA)، (2) DHA فقط (DHA) أو (3) حمية ALA + DHA بعد حمية ALA لمدة 4 أسابيع. A: تعبير mRNA، (B) محتوى البروتين، (C) نشاط الإنزيمات و (D) مسار تخليق n-3 PUFA مع الإنزيمات. تم تحديد الطبيعية باستخدام اختبار شابيرو-ويلك وتم تحويل البيانات غير الطبيعية إلى لوغاريتمات قبل إجراء المزيد من التحليل الإحصائي. حروف مختلفة ( “، و ج) تمثل اختلافات ذات دلالة إحصائية ( تم تحديد الفروق بين الحميات لجين أو بروتين أو نشاط إنزيمي بواسطة تحليل التباين الأحادي (ANOVA) تلاه اختبار توكي HSD بعد الاختبار. جميع القيم مُبلغ عنها كمتوسطات. SEM ). أLA، -حمض اللينولينيك، 18:3n-3؛ DHA، حمض الدوكوساهيكسانويك، 22:6n-3؛ Elovl، إطالة السلسلة الطويلة جداً؛ Fads، ديساتوراز الدهون؛ HSD، الفرق المعنوي الحقيقي.
الكبد EPA و DPAn-3 و DHA ) وللسيروم ALA و EPA و DPAn-3 ( SEM). على وجه التحديد، كانت مستويات EPA في الكبد والمصل لدى الحيوانات الضابطة مشابهة بين الحيوانات التي تغذت على ALA فقط وتلك التي تغذت على DHA فقط، كانت مستويات EPA في الحيوانات التي تغذت على ALA + DHA أعلى. ) من كلا النظامين الغذائيين الآخرين. علاوة على ذلك، كان مستوى EPA في الكبد أعلى في الفئران KO التي تم تغذيتها فقط بـ ALA ( ) مقارنةً بالتحكم ( )، دون وجود اختلافات في كميات EPA في الكبد بين الأنماط الجينية بالنسبة لـ DHA فقط ( 0.04 و ، على التوالي) أو الحيوانات التي تم تغذيتها بـ ALA + DHA ( و على التوالي). في المصل، كانت مستويات EPA أعلى في الفئران المعدلة وراثيًا التي تتلقى ALA فقط ) و ALA +
مغذى بـ DHA الحيوانات مقارنة بالحيوانات الضابطة و ، على التوالي). في الكبد والمصل، كانت مستويات DPAn-3 أعلى في حيوانات KO من أي من مجموعات التغذية بـ DHA، لكن كانت مستويات DHA في الكبد أقل في الحيوانات المعدلة وراثيًا مقارنةً بالضوابط في مجموعة ALA فقط. مقابل ، على التوالي) ومجموعة ALA + DHA ( مقابل “، على التوالي)، وأظهرت مستويات DHA في المصل تأثيرًا رئيسيًا للجينوتيب حيث كانت مستويات DHA أقل في الحيوانات المعدلة جينيًا (KO) ) مقارنةً بالتحكم ( ).
الشكل 5. تركيزات N-3 PUFA في كبد ذكور الفئران المعدلة وراثيًا Elovl2 KO والفئران الضابطة التي تم تغذيتها لمدة 4 أسابيع بـ: (1) ALA فقط (ALA)، (2) DHA فقط (DHA) أو (3) حمية ALA + DHA بعد حمية ALA لمدة 4 أسابيع. A: المصل و (B) الكبد. تم تحديد طبيعة التوزيع باستخدام اختبار شابيرو-ويلك وتم تحويل البيانات غير الطبيعية إلى لوغاريتمات قبل إجراء التحليل الإحصائي الإضافي. تم تحديد التفاعل الكبير والتأثيرات الرئيسية للجين والنظام الغذائي بواسطة تحليل التباين ثنائي الاتجاه. تم تقييم التأثيرات الرئيسية للنظام الغذائي بشكل إضافي بواسطة اختبار توكي بعد الاختبار. نتيجة لتأثير التفاعل الكبير، تمثل الحروف المختلفة (أ، ب، وج) اختلافات ذات دلالة إحصائية. ) بين الحميات لحمض دهني محدد ضمن النمط الجيني كما تحدده تحليل التباين الأحادي (ANOVA) متبوعًا باختبار توكي (Tukey’s HSD) بعد الاختبار، و (*) تمثل الفروق ذات الدلالة الإحصائية لحمض دهني محدد بين الأنماط الجينية وداخل حمية كما تحدده الاختبارات المستقلة اختبار. بالنسبة لـ DHA في المصل، يمثل تأثيرًا رئيسيًا للنظام الغذائي حيث ALA DHA ALA + DHA و يمثل تأثيرًا رئيسيًا للجينوتيب حيث CTL KO. جميع القيم مُبلغ عنها كمتوسطات SEM ). ألا، -حمض اللينولينيك، 18:3n-3؛ DHA، حمض الدوكوساهيكسانويك، 22:6n-3؛ DPAn-3، حمض الدوكوسابنتاينويك n-3، 22:5n-3؛ Elovl2، إطالة السلسلة الطويلة جداً 2؛ EPA، حمض الإيكوسابنتاينويك، 20:5n-3؛ HSD، الفرق المعنوي الحقيقي.

محتوى الكربون-13 من الأحماض الدهنية غير المشبعة n-3 في المصل والكبد لفئران Elovl2 KO المحددة للكبد التي تم تغذيتها بـ ALA أو DHA أو ALA + DHA

المصل (الشكل 6A-C) والكبد (الشكل 6D-F) تم تحديد C-ALA و EPA و DHA لفئران Elovl2 KO المحددة للكبد والفئران الضابطة التي تم تغذيتها بأنظمة غذائية تحتوي على ALA أو DHA أو ALA + DHA لمدة 4 أسابيع بعد نظام غذائي يحتوي على ALA فقط لمدة 4 أسابيع. لم يكن هناك أي تأثير للجينوتيب على مصل الدم أو الكبد. -ألا، أو تم تحديد تأثيرات رئيسية كبيرة للنظام الغذائي على مصل الدم ألا مصل مصل سي-دي إتش إيه الكبد -ألا الكبد ، وكبد في كل من المصل والكبد، -ALA كان أعلى في مجموعة DHA فقط و SEM، على التوالي) مقارنةً بكل من مجموعة ALA
و ، على التوالي) ومجموعة ALA + DHA ( و على التوالي)، مع عدم وجود اختلاف بين مجموعتي ALA و ALA + DHA في كل من المصل والكبد، كان C-EPA أعلى في النظام الغذائي الذي يحتوي فقط على DHA و ، على التوالي)، تليها حمية ALA + DHA و ، mUr، على التوالي) ونظام ALA الغذائي فقط ( و المصل والكبد، على التوالي. كان مستوى DHA أعلى في حميات DHA فقط و ALA + DHA إلى ) مقارنة بنظام غذائي يعتمد فقط على ALA و ، على التوالي). مقارنةً بمصل الدم والكبد استجابة مماثلة لـ تم العثور على DPAn-3، ولكن مع تأثير جيني صغير ولكنه مهم إضافي (الشكل التكميلي S3).
الشكل 6. مستويات الكربون-13 من ALA وEPA وDHA ) من ذكور الفئران المعدلة وراثيًا Elovl 2 KO والفئران الضابطة التي تم تغذيتها لمدة 4 أسابيع بـ: (1) ALA فقط (ALA)، (2) DHA فقط (DHA) أو (3) حمية ALA + DHA بعد حمية ALA لمدة 4 أسابيع. A: ALA في المصل، (B) EPA في المصل، (C) DHA في المصل، (D) ALA في الكبد، (E) EPA في الكبد و(F) DHA في الكبد. تم تحديد طبيعة التوزيع باستخدام اختبار شابيرو-ويلك وتم تحويل البيانات غير الطبيعية إلى لوغاريتمات قبل إجراء التحليل الإحصائي الإضافي. تم تحديد التفاعل الكبير والتأثيرات الرئيسية للجين والنظام الغذائي بواسطة تحليل التباين ثنائي الاتجاه. تم تقييم التأثيرات الرئيسية للنظام الغذائي بشكل إضافي بواسطة اختبار توكي بعد الاختبار، حيث بالنسبة للمصل والكبد -ALA (*) يمثل تأثير النظام الغذائي لـ (ALA للسيروم والكبد يمثل تأثير النظام الغذائي لـ ALA ALA + DHA DHA وللسيروم والكبد -DHA ( ) يمثل تأثير النظام الغذائي لـ ALA (DHA ALA + DHA). جميع القيم مُبلغ عنها كمتوسطات SEM ). وفرة الكربون-13؛ -ألا يعني أنظمة ALA و ALA+DHA؛ -DHA يعني (mUr) من حميات DHA و ALA+DHA؛ ALA، -حمض اللينولينيك، 18:3n-3؛ DHA، حمض الدوكوساهيكسانويك، 22:6n-3؛ Elovl2، إطالة السلسلة الطويلة جداً 21 EPA، حمض الإيكوسابنتاينويك، 20:5n-3.

تثبيط DHA لـ ELOVL2/5 (EPA DPAn-3) بواسطة اختبار تنافس نشاط الإنزيم

باستخدام العزلات الميكروسومية من فئران BALB/c التي تتغذى على العلف، تم إجراء اختبار تنافسي لنشاط الإنزيم ( بروتين تم تقييم SEM) من EPA إلى إطالة DPAn-3 (ELOVL2/5) باستخدام DHA (0.5، ، و ) كمثبط وتم ملاءمته لنموذج مايكلس-مينتن (الشكل 7A). أدت زيادة مستويات DHA إلى انخفاض في من السيطرة إلى ، و0.012 في وجود ، و من DHA. الـ أو كمية الركيزة المطلوبة للوصول إلى ، كانت ، و من وكالة حماية البيئة عند وجود ، و DHA، على التوالي. تم استخدام مجموعة منفصلة من عينات الكبد لعزل الميكروسومات وتم إجراء اختبارات تثبيط إنزيم إضافية في وجود ، و من DHA (الشكل 7B) أو التحكم بحمض البالمتيك (الشكل 7C). كانت نشاط إنزيم ELOVL2/5 أقل بشكل ملحوظ ( ) من السيطرة عند التعرض لـ ) ، ، و من DHA، مع من DHA أيضًا أقل بكثير من
DHA. على العكس من ذلك، نشاط إنزيم ELOVL2/5 في وجود و حمض النخيل لم يكن مختلفًا ) من السيطرة ( )، لكن حمض النخيل (mg) انخفض بشكل ملحوظ ) النشاط مقارنة بجميع مستويات حمض النخيل الأخرى.

تغيير في مستويات EPA في البلازما لدى البشر الذين تم تزويدهم بـ /يوم من DHA لـ أسابيع

تم تقييم دور الجنس والوراثة على التغيرات في مستويات EPA في بلازما النساء والرجال الشباب بعد 12 أسبوعًا من مكملات DHA (الشكل 8). لم يظهر SNP ELOVL2، rs953413، أي تأثير تفاعلي كبير. )، ولا تأثير كبير للجنس (الشكل 8A). ومع ذلك، فإن هناك تأثيرًا كبيرًا ) من rs953413 تم تحديده مما أدى إلى زيادة أكبر في مستويات EPA في البلازما للأفراد ذوي النمط الجيني AA SEM) مقارنةً بأولئك الذين لديهم جينوتيب GA أو GG . أخيرًا، تم تقييم تفاعل الجنس مع SNP FADS1، rs174537، ولم تكشف عن أي تأثيرات تفاعلية ذات دلالة إحصائية ( ) أو التأثيرات الرئيسية لـ أو rs174537 ( ) (الشكل 8B).
الشكل 7. اختبارات نشاط الإنزيم لتثبيط إطالة EPA إلى DPAn-3 (ELOVL2/5) بواسطة DHA وحمض النخيل. A: اختبار تنافس الإنزيم في وجود DHA ( لكل نقطة بيانات)، ونشاط الإنزيم الخاص بالتمديد في حضور ، و من أي من (B) DHA ( ) أو ( C ) حمض النخيل (تحكم، ) في الميكروسومات المعزولة. تم تحديد الطبيعية باستخدام اختبار شابيرو-ويلك وتم تحويل البيانات غير الطبيعية إلى لوغاريتم قبل إجراء المزيد من التحليل الإحصائي. تمثل الحروف المختلفة (أ، ب، وج) اختلافات ذات دلالة إحصائية ( بين مستويات علاج DHA أو حمض النخيل كما تم تحديده بواسطة تحليل التباين الأحادي متبوعًا باختبار توكي HSD بعد الاختبار. جميع القيم مُبلغ عنها كمتوسطات. SEM ). DHA، حمض الدوكوساهيكسانويك، 22:6n-3؛ DPAn-3، حمض الدوكوسابنتاينويك n-3، 22:5n-3؛ EPA، حمض الإيكوسابنتاينويك، 20:5n-3؛ HSD، الفرق المعنوي الحقيقي.

نقاش

في هذه الدراسة، استخدمنا نماذج مختلفة لتحديد الآلية التي يتم من خلالها تقليل تخليق DHA بواسطة تناول DHA الغذائي. تشمل هذه النماذج (1) دراسات غذائية تظهر زيادة في EPA المشتق من كل من ALA وDHA في الفئران البرية، والفئران الضابطة، وفئران Elovl2 KO المحددة للكبد بعد تناول DHA، (2) تعبير الجينات، ومحتوى البروتين، ونشاط إنزيمات PUFA desaturase/elongase في الفئران البرية بعد تناول DHA، (3) اختبارات تثبيط الإنزيمات في العزلات الميكروسومية لقياس إطالة EPA إلى DPAn-3 في وجود DHA، و(4) SNP بشري في جين ELOVL2 في البالغين الذين يتناولون مكملات DHA والذي يساهم في زيادة EPA في البلازما. تدعم هذه الأدلة المتراكمة دراساتنا السابقة على الحيوانات (36) والبشر (24) التي تظهر أن الزيادة في EPA بعد تناول DHA الغذائي تعود إلى تقليل استقلاب EPA في المراحل اللاحقة وليس زيادة التحويل العكسي لـ DHA إلى EPA، وتحدد إطالة EPA، في
بشكل خاص بواسطة ELOVL2، كهدف مثبط جديد ومهم لـ DHA من خلال مسار التغذية الراجعة السلبية. بشكل جماعي، تُظهر أعمالنا للمرة الأولى أن DHA الغذائي يقلل من تخليق نفسه في الكبد عن طريق تثبيط إطالة EPA.
لم نثبت أي تأثيرات كبيرة لحمية ALA وDHA وALA + DHA على تركيزات DHA في الدماغ، ولكن باستخدام CSIA تم تحديد أنه في غياب DHA الغذائي، يحصل الدماغ على DHA المُصنّع من ALA، مما يؤكد نتائجنا السابقة في فئران C57Bl/6J وBALB/c (37، 46، 47). علاوة على ذلك، فإن النمط بالنسبة للدماغ (DHA ، الشكل 1) يتطابق مع المصل (الشكل 6C) وعلى الرغم من أن الدماغ -DHA أقل بشكل عام بسبب معدل دوران DHA البطيء نسبيًا، ومع مرور الوقت نتوقع أن الدماغ -DHA لتمثيل -تم توفير DHA من المصل، كما تم إظهاره سابقًا (47). ثم قمنا بإعادة تلخيص النتائج من الدراسات السابقة على الحيوانات (25-32) والبشر (16-24) التي أظهرت زيادة في مستوى EPA في البلازما/المصل والكبد بعد تغذية DHA (الشكل 2). ومع ذلك، فإن مستويات EPA
الشكل 8. التغير من خط الأساس في تركيزات EPA في البلازما بعد 12 أسبوعًا من مكملات DHA اليومية حسب الجنس والنمط الجيني. A: rs953413 و (B) rs174537. تم تحديد طبيعة التوزيع باستخدام اختبار شابيرو-ويلك وتم تحويل البيانات غير الطبيعية إلى لوغاريتم قبل إجراء المزيد من التحليل الإحصائي. الدلالة الإحصائية ( تم تحديد التفاعلات أو التأثيرات الرئيسية للجنس والنمط الجيني بواسطة تحليل التباين الثنائي. القيم معبّر عنها كمتوسطات SEM. بالنسبة لـ rs953413، n = 4 (أنثى AA)، 4 (ذكر AA)، 11 (أنثى GA + GG)، و 11 (أنثى GA + GG)، وبالنسبة لـ rs174537، (GG أنثى)، 8 (GG ذكر)، 7 (GT + TT أنثى)، و7 (GG + TT ذكر). DHA، حمض الدوكوساهيكسانويك، 22:6n-3؛ ELOVL، إطالة السلسلة الطويلة جداً؛ EPA، حمض الإيكوسابنتاينويك، 20:5n-3؛ FADS، ديساتوراز الأحماض الدهنية.
ازداد فقط مع تغذية DHA في وجود ALA ولم يكن هناك فرق بين الحيوانات التي تغذت على ALA أو DHA فقط، مما يدل على أن ALA ضروري لزيادة EPA مع تغذية DHA. وبالمثل، الفئران التي تغذت على حمية ALA (في إجمالي الدهون) أو لم يختلف نظام DHA الغذائي في تركيزات EPA في الجسم بالكامل، بينما كانت مستويات EPA في أنسجة الجرذان التي تلقت كلا النظامين الغذائيين أعلى مقارنة بتلك التي تلقت نظامًا غذائيًا منخفضًا في ALA. ومع ذلك، كانت مستويات DPAn-3 في المصل/الكبد في مجموعة DHA أقل من أي من مجموعة ALA، ربما بسبب وجود مصدر غذائي واحد فقط لـ DPAn-3 في مجموعة DHA مع تثبيط إطالة EPA. على العكس من ذلك، لا يزال هناك مصدر واحد فقط لـ DPAn-3 في مجموعة ALA، ولكن عدم وجود التثبيط يسمح بتخليق DPAn-3 بحرية من EPA مما يؤدي إلى مستويات أعلى من DPAn-3 في مجموعة ALA مقارنة بمجموعة DHA.
تتطلب ضرورة دمج ALA + DHA لزيادة EPA معلومات حيوية حول آلية زيادة EPA. نظرًا لأن ALA هو سلف لـ EPA، يجب أن تكون أي زيادة في EPA نتيجة لبطء عملية الأيض لـ EPA المشتق من ALA. علاوة على ذلك، استخدمنا مستويات عالية من -DHA من -11.0 إلى -14.0 مUr مقارنة بمستخلص بذور الكتان -ALA من -31.2 إلى -34.0 مUr. وهذا يسمح بتحديد المصدر الذي يقف وراء تراكم EPA، سواء من ALA أو DHA، في كل من الحميات. وبالتالي، الكبد والمصل من فئران BALB/c لم تكن هناك اختلافات بين حميات ALA و ALA + DHA مما يشير إلى أن معظم زيادة EPA جاءت من ALA (الشكل 3). تم التنبؤ بهذه النتائج من خلال دراساتنا السابقة على الجرذان (36) والبشر (24). ومع ذلك، على الرغم من أن تظهر الفئران التي تم التحكم فيها من دراسة Elovl2 KO نفس النمط لمستويات الأحماض الدهنية (الشكل 5)، المصل، والكبد -تشير مستويات EPA إلى مساهمة مختلطة من ALA و DHA (الشكل 6)، والتي سيتم مناقشتها بمزيد من التفصيل لاحقًا. في فئران BALB/c، لا يحدث ذلك حتى يتم إزالة ALA من النظام الغذائي. تزداد نحو مستوى DHA، مما يكشف أن معدلات التحويل العكسي بطيئة وأن DHA ليس مصدرًا رئيسيًا لـ EPA حتى تكون تناولات ALA منخفضة.
على الرغم من عدم وجود مسار معروف لتحويل DHA إلى ALA، فإن مصل الدم والكبد -ALA كان أعلى في مجموعة DHA مما يشير إلى إمكانية وجود مسار عندما تكون تناولات ALA منخفضة جداً. بدلاً من ذلك، -الأكسدة تفضل الجزيئات فوق الجزيئات، وهي عملية تعرف بالتفريق النظائري للكربون (49)، والتي قد تفسر الارتفاع في -ALA المتبقية في الجسم. علاوة على ذلك، على الرغم من عدم إجراء تحليلات إحصائية لمقارنة مصل الدم والكبد القيم، قد يكون هناك اتجاه نحو انخفاض PUFA مقارنة بالكبد، مما يشير إلى أن الأنسجة الدهنية، مع عمر نصف DHA يتراوح بين 5-8 أيام أو حتى 30 يومًا من DHA الغذائي أو ALA، على التوالي (37)، قد تساهم لا يزال في مصل الدم المستويات بعد 28 يومًا من الارتفاع تغذية DHA. على الرغم من أن الكبد -ALA (لكن ليس مصل) كان مستوى C-ALA) أعلى بشكل غير متوقع في مجموعة ALA مقارنة بمجموعة ALA + DHA، وهذا عكس اختلافات C-ALA في الحميات الغذائية قد تشير مرة أخرى إلى تأثير الأحماض الدهنية غير المشبعة n-3 المخزنة في الدهون التي تؤثر بشكل مختلف على مصل الدم والكبد. القيم.
كلا النظامين الغذائيين المحتويين على DHA قللا من تعبير mRNA، ومحتوى البروتين، ونشاط الإنزيم FADS2، لكنهما أثرا فقط على محتوى البروتين ونشاط الإنزيم FADS1 (الشكل 4). وهذا يشير إلى أنه على الرغم من أن الزيادات في DHA تبدو أنها تؤثر على نشاط كلا الإنزيمين المزيلين للترطيب، فإن الآلية التي يحدث بها ذلك قد تكون نسخًا لـ FADS2 وترجمة لـ FADS1. ومع ذلك، مع تفاعل FADS2 الذي يُفترض أنه محدد المعدل، والتفاعل الوحيد لـ FADS1 الذي يحدث قبل EPA في المسار، لا يُتوقع أن يكون أي من هذين الإنزيمين متورطًا في تراكم EPA مع تغذية DHA. بدلاً من المزيلات للترطيب (FADS1/2)، تساهم الإطالة (ELOVL2/5) بشكل متساوٍ نسبيًا في إطالة EPA إلى DPAn-3 وقد تم تحديدها كنقاط تحكم حاسمة في DHA.
مسار التخليق الحيوي (50). مقارنةً بتغذية ALA، بدا أن DHA يقلل من تعبير mRNA لـ Elovl2 و Elovl5؛ ومع ذلك، لم يتم الوصول إلى الدلالة في مجموعة ALA + DHA، ولم يترجم هذا الانخفاض إلى محتوى بروتين أقل. علاوة على ذلك، لم تؤثر تغذية DHA على نشاط ELOVL5 أو النشاط المشترك لـ ELOVL2/5؛ ومع ذلك، كان نشاط ELOVL2 أقل في كلا مجموعتي تغذية DHA مقارنةً بمجموعة تغذية ALA. هناك قيود على اختبار نشاط الإنزيم: (1) الميكروسومات هي قطع مجزأة من الشبكة الإندوبلازمية التي قد لا تمثل الدعم الهيكلي الطبيعي لإنزيمات الإطالة والتشبع، و(2) قد يتغير تركيب الأحماض الدهنية التي تتعرض لها الميكروسومات المعزولة مقارنةً بالخلايا السليمة. ومع ذلك، أظهرنا أن نشاط ELOVL2 ينخفض بشكل مستقل عن التغيرات في محتوى البروتين، مما يشير إلى أن DHA يمارس تعديلات بعد الترجمة على ELOVL2، ولكن ليس على ELOVL5.
مع إشارة اختبار نشاط الإنزيم إلى تثبيط ELOVL2 مع زيادة مستويات DHA، قمنا بتكرار دراسة التغذية ALA وDHA أو ALA + DHA في الفئران المعدلة وراثيًا Elovl2 الخاصة بالكبد والفئران الضابطة للتحقيق في كيفية تأثير مستويات n-3 PUFA و قارن في وجود أو غياب كبد وظيفي Elov12. الكبد هو النسيج النشط الرئيسي لمسار الأحماض الدهنية غير المشبعة n-3 وهو أكثر الأنسجة وفرة في التعبير عن Elovl2 في القوارض (51). على الرغم من الحفاظ على نماذج غذائية مختلفة، فإن نموذج Elovl2 KO الكامل للجسم أظهر أنماط مماثلة من EPA وDHA في المصل والكبد مقارنةً بنموذج Elovl2 KO الخاص بالكبد لدينا (52)، مما يشير إلى أن نموذج Elovl2 KO الكامل للجسم مشابه من الناحية الأيضية لإزالة الكبد فقط. في كل من الكبد والمصل لنماذج KO الخاصة بالكبد لدينا، كانت مستويات EPA وDPAn-3 أعلى في الفئران KO التي تغذت على ALA مقارنةً بالتحكم، مما يدل على التراكم المتوقع لمواد ELOVL2 نتيجة لإزالة Elovl2 من الكبد. لم تؤدِ إزالة Elovl2 إلى أي زيادة إضافية في مستويات EPA في الكبد بعد تغذية DHA أو ALA + DHA مقارنةً بالفئران التحكم. النتائج في المصل متطابقة تقريبًا مع الكبد، مع استثناء واحد، حيث أظهرت الفئران KO التي تغذت على ALA + DHA مستويات أعلى بشكل ملحوظ من EPA في المصل مقارنةً بالفئران التحكم على نفس النظام الغذائي. علاوة على ذلك، فإن المصل -نمط DHA يتطابق تقريبًا مع نمط الدماغ بشكل متطابق. من المهم أنه لم يكن هناك تفاعل (حمية تأثيرات النمط الجيني) أو تأثيرات النمط الجيني على المصل أو الكبد يكشف أن مصدر الزيادة في EPA لدى الفئران التي تغذت على DHA كان هو نفسه في كل من مجموعات KO والمجموعة الضابطة. وهذا يشير إلى أن آلية الزيادة في EPA، KO/تثبيط إطالة EPA، قد تكون أيضًا هي نفسها. بشكل مذهل، تشير نتائجنا إلى أن تغذية DHA قد يكون لها تأثير مشابه على نشاط ELOVL2 في الكبد مقارنةً مع KO الكامل للكبد Elovl2. ومع ذلك، فإن تأثير النظام الغذائي الذي تم تحقيقه في الفئران تظهر مستوى وسيط مستويات C-EPA في مجموعة ALA + DHA، بينما المجموعتان اللتان تغذيان بـ DHA في فئران BALB/c ليستا مختلفتين مما يشير إلى مساهمة كل من ALA وDHA في زيادة EPA. عندما
هناك مصدران للأحماض الدهنية، مثلما في مجموعة نظامنا الغذائي ALA + DHA، يمكن حساب المساهمة النسبية لـ ALA و DHA في EPA. . نتيجة لذلك، نقدر أن تم اشتقاق EPA من ALA في مصل الفئران BALB/c (الشكل التكميلي S4A)، بينما تم اشتقاق EPA من ALA في مصل الدم في فئران C57Bl/6J بغض النظر عن النمط الجيني (الشكل التكميلي S4B). دعمًا لهذه النتائج، قمنا سابقًا بتطبيق نفس النمذجة لتقدير مساهمة ALA الغذائي في EPA الكبدية لتكون في جرذان لونغ-إيفانز على نظام غذائي يحتوي على ALA + DHA (36)، مما يشير إلى أن الغالبية العظمى من الزيادة في EPA مع تغذية DHA تأتي من ALA. علاوة على ذلك، تشير التشابهات بين الفئران الضابطة وفئران KO إلى أنه مع تغذية DHA يتم تحويل كمية أقل من ALA إلى EPA ومن ثم إلى DHA، مما يترافق مع الدماغ. تشير قيم DHA إلى أن زيادة DHA توقف تخليقه في الكبد لمنع تكرار إمدادات DHA في الدماغ.
على الرغم من أن دراسات التغذية لدينا في الفئران WT وcontrol وElovl2 KO تظهر بوضوح أن إطالة EPA مثبطة بواسطة DHA، إلا أن طبيعة هذا التثبيط لا يمكن توضيحها من خلال تركيزات الأحماض الدهنية و القيم وحدها. لذلك، قمنا بعزل الميكروزومات من الفئران التي تتغذى على الطعام العادي لإجراء اختبار تنافسي وتحديد كيفية تأثير DHA ( يعيق وكالة حماية البيئة إطالة إلى DPAn-3. الـ تقلص تفاعل إطالة EPA مع كل زيادة متتالية في جرعة DHA، مما يدل على أن هذا ليس تثبيطًا تنافسيًا، وأن DHA لا يشغل نفس الموقع الإنزيمي مثل EPA. هذا يتعارض مع ما قد نتوقع رؤيته مع الركائز المعروفة لـ ELOVL2 مثل DPAn-3، وحمض الأراكيدونيك (20:4n-6)، أو حمض الأدرينيك. . الـ الذي يمثل من ، انخفض من 0 إلى DHA (المنحدر ) ثم استقر من 10 إلى 100 مليمول DHA (ميل ) (الشكل 7A). مقترنًا مع انخفاض (1) تناقص يكشف عن تثبيط غير تنافسي حيث يرتبط المثبط بالإنزيم بعد تشكيل معقد الإنزيم-substrate لمنع حدوث التفاعل، و (2) ثابت تشير إلى تثبيط غير تنافسي حيث يرتبط المثبط بالإنزيم مما يمنع الركيزة من الارتباط (54). لذلك، عند مستويات منخفضة من DHA، يرتبط DHA بإنزيم ELOVL2 بعد ارتباط EPA لتشكيل معقد الإنزيم-الركيزة ويغير نشاط ELOVL2 من خلال التثبيط غير التنافسي. عند مستويات أعلى من DHA، إما أن (1) يرتبط DHA بالإنزيم الممتد قبل ارتباطه بـ EPA، مما يمنع EPA من الارتباط بالموقع النشط على ELOVL2، أو (2) يرتبط بـ ELOVL5 مما يضيف تثبيطًا إضافيًا غير تنافسي لتمديد EPA. نظرًا للقيود في ألفة الإنزيم لـ EPA في هذا الاختبار، يجب استخدام مستويات EPA فوق الفسيولوجية للحصول على مستويات قابلة للقياس من منتج DPAn-3. ومع ذلك، فإن النسب النسبية لمثبط DHA إلى مستويات ركيزة EPA في الاختبار (من 1:40 حتى 4:1 DHA:EPA) قابلة للمقارنة مع ما تم الإبلاغ عنه سابقًا من القيم الفسيولوجية.
نسب DHA:EPA في الكبد على الرغم من أنه لا يزال أقل مما هو موضح في كبد الفئران لدينا (حد أدنى 12:1 في الفئران الضابطة).
لاختبار نتائجنا المتعلقة بالحيوانات على البشر، قمنا أيضًا بإجراء تحليل ثانوي لتجربة عشوائية محكومة (RCT) تم نشرها سابقًا على رجال ونساء شباب تم تزويدهم بـ يوم DHA لمدة 12 أسبوعًا (24، 40). في تلك الدراسة، زادت مكملات DHA مستويات EPA في البلازما من 59 إلى ومع ذلك، فإن القيم لم تتغير على الرغم من الارتفاع الكبير في -DHA من المكمل. إذا حدثت زيادة في التحويل العكسي، فإن في البلازما كان سيتحول نحو ذلك من في الملحق؛ ومع ذلك، فإن عدم التغيير في البلازما أشارت إلى أن مصدر الـ EPA الأعلى كان أساسًا ALA. في الدراسة الحالية، قمنا بتقسيم البيانات حسب الجنس و SNP ELOVL2 rs953413 ووجدنا أن التغير في EPA البلازمي كان يعتمد بشكل محتمل على rs953413، حيث أدى النمط الجيني AA إلى زيادة ملحوظة في EPA مقارنة بالنمط الجيني المركب GA + GG. على الرغم من وجود اتجاه لتأثير الجنس ( ) تم الكشف عن أنه قد يكون دافعًا لهذه النتائج، نظرًا للطبيعة الثانوية لتحليلنا قد نكون غير قادرين على اكتشاف هذا التأثير، وتكون التجارب السريرية الإضافية ذات القوة المناسبة مبررة. ومع ذلك، تم تقييم دور هذا SNP rs953413، بالإضافة إلى SNPs rs3734398 و rs2236212 ELOVL2، في مجموعة سكانية مختلطة الجنس بعد 6 أشهر من ، و مكملات زيت السمك (57). بعد بالنسبة للجرعة فقط، كانت هناك تأثيرات جينية ملحوظة على مستويات EPA لكل من SNPs المذكورة أعلاه، حيث أظهر النمط الجيني GA + AA لـ rs953413 مستويات EPA أعلى بشكل ملحوظ مقارنة بالنمط الجيني GG. ومع ذلك، مع مكملات زيت السمك المختلط EPA + DHA، لا يمكن التوصل إلى استنتاجات قاطعة حول مصدر الزيادة في EPA. يقع SNP rs953413 ضمن منطقة معززة محفوظة تطوريًا، ويعمل كمنظم مهم لتعبير ELOVL2، خاصة من خلال تعاون FOXA1/FOXA2 وHNF4. لزيادة التعبير في الأليل G (58). إذا كان من المفترض أن يقلل مكمل DHA من FOXA1 و FOXA2 و/أو HNF4 ، قد يؤدي هذا إلى تقليل تنظيم التعبير في النمط الجيني GG، مما يؤدي إلى زيادة نسبية أكبر في EPA لأولئك الذين لديهم النمط الجيني AA. ومع ذلك، حسب علمنا، لم يتم التحقيق في تأثيرات مكملات DHA على مستويات هذه البروتينات، مما يمثل مجالًا مثيرًا للبحث.
إن تثبيط استقلاب EPA مع مكملات DHA له تداعيات كبيرة على فهمنا لكيفية حصول الأنسجة، مثل الدماغ، على DHA. تظهر نتائجنا أنه عندما يتم استهلاك DHA في النظام الغذائي، فإنه يثبط تخليقه من ALA عن طريق تقليل إطالة EPA الذي يتراكم بعد ذلك. وبالتالي، عندما لا يمكن تقييم الكبد مباشرة، مثلما هو الحال في الدراسات السريرية، يمكن استخدام زيادة EPA مع CSIA كبديل لـ
قياس تثبيط إطالة EPA. على العكس من ذلك، عندما يكون DHA غائبًا في النظام الغذائي، كما هو شائع لدى النباتيين وأولئك الذين لا يتناولون الأسماك، فإن إطالة EPA لا تتعرض للتثبيط، ويمكن استخدام ALA لتخليق DHA. هناك حاجة لأعمال مستقبلية تفحص تأثيرات التطور، والوراثة، والضغط على استجابة هذا المسار. بالإضافة إلى ذلك، تظهر أدبيات تشير إلى أن DHA قد يغير التأثيرات الناتجة عن EPA. لم تكن التجارب السريرية العشوائية التي تستخدم مكملات مختلطة من EPA/DHA لتقليل نقاط نهاية الأمراض القلبية الوعائية ناجحة. بينما أبلغت تجربتان عشوائيتان مضبوطة عن فوائد قلبية وعائية عند تناول EPA بمفرده (63، 64). وقد تم تحديد نتائج مشابهة في التحليل التلوي للاكتئاب الشديد (65). يمكن أن تساعد نتائجنا الميكانيكية في تفسير النتائج المتناقضة للتجارب العشوائية المضبوطة. عندما يتم تناول EPA بمفرده، فإنه يكون متاحًا للتحويل اللاحق إلى DPAn-3 و metabolits النشطة حيويًا. ومع ذلك، عندما يتم دمجه مع DHA، يتم تثبيط استقلاب EPA ويكون أقل توفرًا لإنتاج المستقلبات المحتملة المضادة للالتهابات.
باختصار، لقد أظهرنا بوضوح أن تراكم EPA مع زيادة مستويات DHA ينتج بشكل أساسي عن ضعف إطالة EPA إلى DPAn-3 في نظام تغذية راجعة سلبية عبر تثبيط غير تنافسي للإنزيمات المعنية، على الأرجح ELOVL2 في الكبد. علاوة على ذلك، يظهر الأفراد الذين يحملون النمط الجيني AA في SNP ELOVL2، rs953413، زيادات أكبر في EPA مع مكملات DHA. على الرغم من أننا لم نكشف عن أي تأثيرات جنسية، إلا أنه لوحظ اتجاه، وقد نكون قد كنا غير قادرين على اكتشاف هذه الاختلافات، وينبغي أن تركز الدراسات المستقبلية على التحقيق في التأثيرات الخاصة بالجنس لتثبيط إطالة EPA بواسطة DHA الغذائي. في الختام، يكشف تثبيط تخليق DHA في الكبد بواسطة DHA الغذائي عن آلية يتحكم بها DHA الغذائي في مصدر وتوصيل DHA إلى الدماغ.

توفر البيانات

سيتم مشاركة بيانات إضافية عند الطلب من المؤلف المراسل (أ. ح. م.). بري

بيانات إضافية

تحتوي هذه المقالة على بيانات إضافية.

شكر وتقدير

تم إجراء تحليل GC-C-IRMS بواسطة مختبر النظائر البيئية، قسم علوم الأرض والبيئة في جامعة واترلو (UW-EIL) بمساعدة ريس غوين. تم دعم هذا العمل من قبل مجلس أبحاث العلوم الطبيعية والهندسة في كندا (RGPIN-2017-06465)، ومعاهد أبحاث الصحة الكندية (PJT-173507) ووزارة الزراعة والغذاء والشؤون الريفية في أونتاريو (2093).

مساهمات المؤلفين

أ. هـ. م.، ر. ف.، ب. ج. ك.، ج. س.، ر. د. ر.، و م. ج.-س. التحقيق؛ أ. هـ. م.، ر. ف.، ج. ج.-غ.، د. م. م.، و ر. ب. ب. المنهجية؛ أ. هـ. م.، ر. ف.، ر. د. ر.، و م. ج.-س. الشكلية
تحليل؛ أ. ح. م.، س. ل.، ج. م.، د. م. م. و ر. ب. ب. تصور؛ أ. ح. م.، ج. س.-ج. و ر. ب. ب. تحقق؛ أ. ح. م. تصور؛ أ. ح. م. كتابة المسودة الأصلية؛ ر. ف.، ب. ج. ك.، ج. س.، ر. د. ر.، م. ج.-س.، ج. س.-ج.، س. ل.، ج. م.، د. م. م. و ر. ب. ب. كتابة-مراجعة وتحرير؛ س. ل.، ج. م.، د. م. م. و ر. ب. ب. إشراف؛ ج. س.-ج.، ج. م.، د. م. م. و ر. ب. ب. موارد؛ د. م. م. و ر. ب. ب. إدارة المشروع؛ ر. ب. ب. الحصول على التمويل.

معرفات ORCID للمؤلفين

جوليا سيزبانى ©https://orcid.org/0000-0002-2947-2437
ميليسا غونزاليس-سوتو (دhttps://orcid.org/0000-0003-43095604

تعارض المصالح

تلقى د. م. م. منح بحثية من مجلس الكانولا في كندا ومزارعي الألبان في كندا. تلقى ر. ب. ب. منحًا صناعية، بما في ذلك تلك التي تتطابق مع الحكومة الكندية، و/أو دعم السفر المتعلق بالعمل على امتصاص الأحماض الدهنية في الدماغ من Arctic Nutrition وBunge Ltd وDSM وFonterra وMead Johnson وNestle, Inc. علاوة على ذلك، ر. ب. ب. هو عضو في الهيئة التنفيذية للجمعية الدولية لدراسة الأحماض الدهنية والدهون وعقد اجتماعًا نيابة عن الأحماض الدهنية وإشارات الخلايا، وكلاهما يعتمد على رعاية الشركات. قدم ر. ب. ب. شهادة خبراء تتعلق بالمكملات والدماغ ويشغل كرسي أبحاث كندا في استقلاب الدهون في الدماغ. أ. ح. م. هو عضو في مجلس إدارة ISSFAL. لا يُبلغ أي من المؤلفين الآخرين عن تضارب في المصالح يتعلق بالبحث المقدم في هذه المقالة.

الاختصارات

, وفرة الكربون-13؛ ALA، -حمض اللينولينيك؛ C IRMS، قياس الكتلة النسبية للاحتراق؛ CSIA، تحليل النظائر المحددة للمركبات؛ ELOVL، إطالة السلسلة الطويلة جدًا؛ DPAn-3، حمض الدوكوسابنتاينويك n-3؛ FADS، ديساتوراز الأحماض الدهنية؛ FAMEs، استرات ميثيل الأحماض الدهنية؛ FID، كشف التأين اللهبي؛ RCT، تجربة عشوائية محكومة.
تم استلام المخطوطة في 6 مارس 2024، وفي شكل منقح في 13 أبريل 2024. تم النشر، أوراق JLR في الصحافة، 20 أبريل 2024، https://doi.org/10.1016/jjlr.2024.100548

REFERENCES

  1. Bazinet, R. P., and Laye, S. (2014) Polyunsaturated fatty acids and their metabolites in brain function and disease. Nat. Rev. Neurosci. 15, 771-785
  2. Dyall, S. C., Balas, L., Bazan, N. G., Brenna, J. T., Chiang, N., da Costa Souza, F., et al. (2022) Polyunsaturated fatty acids and fatty acid-derived lipid mediators: recent advances in the understanding of their biosynthesis, structures, and functions. Prog. Lipid Res. 86, 101165
  3. Lee, J. W., Huang, B. X., Kwon, H., Rashid, M. A., Kharebava, G., Desai, A., et al. (2016) Orphan GPR110 (ADGRF1) targeted by Ndocosahexaenoylethanolamine in development of neurons and cognitive function. Nat. Commun. 7, 13123
  4. Liu, J., Sahin, C., Ahmad, S., Magomedova, L., Zhang, M., Jia, Z., et al. (2022) The omega-3 hydroxy fatty acid 7(S)-HDHA is a high-affinity PPARalpha ligand that regulates brain neuronal morphology. Sci. Signal. 15, eabol857
  5. Dalli, J., and Serhan, C. N. (2018) Immunoresolvents signaling molecules at intersection between the brain and immune system. Curr. Opin. Immunol. 50, 48-54
  6. Lukiw, W. J., Cui, J. G., Marcheselli, V. L., Bodker, M., Botkjaer, A., Gotlinger, K., et al. (2005) A role for docosahexaenoic acidderived neuroprotectin D1 in neural cell survival and Alzheimer disease. J. Clin. Invest. 115, 2774-2783
  7. Park, T., Chen, H., and Kim, H. Y. (2019) GPR110 (ADGRF1) mediates anti-inflammatory effects of N-docosahexaenoylethanolamine. J. Neuroinflammation. 16, 225
  8. Akbar, M., Calderon, F., Wen, Z., and Kim, H. Y. (2005) Docosahexaenoic acid: a positive modulator of Akt signaling in neuronal survival. Proc. Natl. Acad. Sci. U S A. 102, 10858-10863
  9. Asatryan, A., and Bazan, N. G. (2017) Molecular mechanisms of signaling via the docosanoid neuroprotectin D1 for cellular homeostasis and neuroprotection. J. Biol. Chem. 292, 12390-12397
  10. Chen, C. T., Domenichiello, A. F., Trepanier, M. O., Liu, Z., Masoodi, M., and Bazinet, R. P. (2013) The low levels of eicosapentaenoic acid in rat brain phospholipids are maintained via multiple redundant mechanisms. J. Lipid Res. 54, 2410-2422
  11. Igarashi, M., Ma, K., Chang, L., Bell, J. M., Rapoport, S. I., and DeMar, J. C., Jr. (2006) Low liver conversion rate of alphalinolenic to docosahexaenoic acid in awake rats on a high-docosahexaenoate-containing diet. J. Lipid Res. 47, 1812-1822
  12. Scott, B. L., and Bazan, N. G. (1989) Membrane docosahexaenoate is supplied to the developing brain and retina by the liver. Proc. Natl. Acad. Sci. U. S. A. 86, 2903-2907
  13. Valenzuela, R., Metherel, A. H., Cisbani, G., Smith, M. E., Choui-nard-Watkins, R., Klievik, B. J., et al. (2023) Protein concentrations and activities of fatty acid desaturase and elongase enzymes in liver, brain, testicle, and kidney from mice: substrate dependency. Biofactors. 50, 89-100
  14. Igarashi, M., DeMar, J. C., Jr., Ma, K., Chang, L., Bell, J. M., and Rapoport, S. I. (2007) Docosahexaenoic acid synthesis from alpha-linolenic acid by rat brain is unaffected by dietary n-3 PUFA deprivation. J. Lipid Res. 48, 1150-1158
  15. Igarashi, M., DeMar, J. C., Jr., Ma, K., Chang, L., Bell, J. M., and Rapoport, S. I. (2007) Upregulated liver conversion of alphalinolenic acid to docosahexaenoic acid in rats on a 15 week n-3 PUFA-deficient diet. J. Lipid Res. 48, 152-164
  16. von Schacky, C., and Weber, P. C. (1985) Metabolism and effects on platelet function of the purified eicosapentaenoic and docosahexaenoic acids in humans. J. Clin. Invest. 76, 2446-2450
  17. Conquer, J. A., and Holub, B. J. (1996) Supplementation with an algae source of docosahexaenoic acid increases (n-3) fatty acid status and alters selected risk factors for heart disease in vegetarian subjects. J. Nutr. 126, 3032-3039
  18. Rambjor, G. S., Walen, A. I., Windsor, S. L., and Harris, W. S. (1996) Eicosapentaenoic acid is primarily responsible for hypotriglyceridemic effect of fish oil in humans. Lipids. 31 Suppl, S45-S49
  19. Conquer, J. A., and Holub, B. J. (1997) Dietary docosahexaenoic acid as a source of eicosapentaenoic acid in vegetarians and omnivores. Lipids. 32, 341-345
  20. Stark, K. D., and Holub, B. J. (2004) Differential eicosapentaenoic acid elevations and altered cardiovascular disease risk factor responses after supplementation with docosahexaenoic acid in postmenopausal women receiving and not receiving hormone replacement therapy. Am. J. Clin. Nutr. 79, 765-773
  21. Schuchardt, J. P., Ostermann, A. I., Stork, L., Kutzner, L., Kohrs, H., Greupner, T., et al. (2016) Effects of docosahexaenoic acid supplementation on PUFA levels in red blood cells and plasma. Prostaglandins Leukot. Essent. Fatty Acids. 115, 12-23
  22. Allaire, J., Harris, W. S., Vors, C., Charest, A., Marin, J., Jackson, K. H., et al. (2017) Supplementation with high-dose docosahexaenoic acid increases the Omega-3 Index more than high-dose eicosapentaenoic acid. Prostaglandins Leukot. Essent. Fatty Acids. 120, 8-14
  23. Guo, X. F., Sinclair, A. J., Kaur, G., and Li, D. (2018) Differential effects of EPA, DPA and DHA on cardio-metabolic risk factors in high-fat diet fed mice. Prostaglandins Leukot. Essent. Fatty Acids. 136, 47-55
  24. Metherel, A. H., Irfan, M., Klingel, S. L., Mutch, D. M., and Bazinet, R. P. (2019) Compound-specific isotope analysis reveals no retroconversion of DHA to EPA but substantial conversion of EPA to DHA following supplementation: a randomized control trial. Am. J. Clin. Nutr. 110, 823-831
  25. Willumsen, N., Vaagenes, H., Lie, O., Rustan, A. C., and Berge, R. K. (1996) Eicosapentaenoic acid, but not docosahexaenoic acid, increases mitochondrial fatty acid oxidation and upregulates 2,
4-dienoyl-CoA reductase gene expression in rats. Lipids. 31, 579-592
26. Depner, C. M., Philbrick, K. A., and Jump, D. B. (2013) Docosahexaenoic acid attenuates hepatic inflammation, oxidative stress, and fibrosis without decreasing hepatosteatosis in a Ldlr(-/-) mouse model of western diet-induced nonalcoholic steatohepatitis. J. Nutr. 143, 315-323
27. Suzuki-Kemuriyama, N., Matsuzaka, T., Kuba, M., Ohno, H., Han, S. I., Takeuchi, Y., et al. (2016) Different effects of eicosapentaenoic and docosahexaenoic acids on atherogenic high-fat diet-induced non-alcoholic fatty liver disease in mice. PLoS One. 11, e0157580
28. Lytle, K. A., Wong, C. P., and Jump, D. B. (2017) Docosahexaenoic acid blocks progression of western diet-induced nonalcoholic steatohepatitis in obese Ldlr-/- mice. PLoS One. 12, e0173376
29. Metherel, A. H., Domenichiello, A. F., Kitson, A. P., Lin, Y. H., and Bazinet, R. P. (2017) Serum n-3 tetracosapentaenoic acid and tetracosahexaenoic acid increase following higher dietary alpha-linolenic acid but not docosahexaenoic acid. Lipids. 52, 167-172
30. Leng, S., Winter, T., and Aukema, H. M. (2018) Dietary ALA, EPA and DHA have distinct effects on oxylipin profiles in female and male rat kidney, liver and serum. J. Nutr. Biochem. 57, 228-237
31. Metherel, A. H., Lacombe, R. J. S., Aristizabal Henao, J. J., MorinRivron, D., Kitson, A. P., Hopperton, K. E., et al. (2018) Two weeks of docosahexaenoic acid (DHA) supplementation increases synthesis-secretion kinetics of n-3 polyunsaturated fatty acids compared to 8 weeks of DHA supplementation. J. Nutr. Biochem. 60, 24-34
32. Drouin, G., Catheline, D., Guillocheau, E., Gueret, P., Baudry, C., Le Ruyet, P., et al. (2019) Comparative effects of dietary n-3 docosapentaenoic acid (DPA), DHA and EPA on plasma lipid parameters, oxidative status and fatty acid tissue composition. . Nutr. Biochem. 63, 186-196
33. Schlenk, H., Sand, D. M., and Gellerman, J. L. (1969) Retroconversion of docosahexaenoic acid in the rat. Biochim. Biophys. Acta. 187, 201-207
34. Lacombe, R. J. S., and Bazinet, R. P. (2021) Natural abundance carbon isotope ratio analysis and its application in the study of diet and metabolism. Nutr. Rev. 79, 869-888
35. Meier-Augenstein, W. (1999) Applied gas chromatography coupled to isotope ratio mass spectrometry. J. Chromatogr. A. 842, 351-371
36. Metherel, A. H., Chouinard-Watkins, R., Trepanier, M. O., Lacombe, R. J. S., and Bazinet, R. P. (2017) Retroconversion is a minor contributor to increases in eicosapentaenoic acid following docosahexaenoic acid feeding as determined by compound specific isotope analysis in rat liver. Nutr. Metab. (Lond.). 14, 75
37. Lacombe, R. J. S., Lee, C. C., and Bazinet, R. P. (2020) Turnover of brain DHA in mice is accurately determined by tracer-free natural abundance carbon isotope ratio analysis. J. Lipid Res. 61, 116-126
38. Domenichiello, A. F., Kitson, A. P., Metherel, A. H., Chen, C. T., Hopperton, K. E., Stavro, P. M., et al. (2017) Whole-body docosahexaenoic acid synthesis-secretion rates in rats are constant across a large range of dietary alpha-linolenic acid intakes. . Nutr. 147, 37-44
39. Metherel, A. H., Lacombe, R. J. S., Chouinard-Watkins, R., and Bazinet, R. P. (2019) Docosahexaenoic acid is both a product of and a precursor to tetracosahexaenoic acid in the rat. J. Lipid Res. 60, 412-420
40. Klingel, S. L., Metherel, A. H., Irfan, M., Rajna, A., Chabowski, A., Bazinet, R. P., et al. (2019) EPA and DHA have divergent effects on serum triglycerides and lipogenesis, but similar effects on lipoprotein lipase activity: a randomized controlled trial. Am. J. Clin. Nutr. 110, 1502-1509
41. Folch, J., Lees, M., and Sloane Stanley, G. H. (1957) A simple method for the isolation and purification of total lipides from animal tissues. J. Biol. Chem. 226, 497-509
42. Metherel, A. H., Irfan, M., Klingel, S. L., Mutch, D. M., and Bazinet, R. P. (2021) Higher increase in plasma DHA in females compared to males following EPA supplementation may be influenced by a polymorphism in ELOVL2: an exploratory study. Lipids. 56, 211-228
43. Klingel, S. L., Roke, K., Hidalgo, B., Aslibekyan, S., Straka, R. J., An, P., et al. (2017) Sex differences in blood HDL-c, the total
cholesterol/HDL-c ratio, and palmitoleic acid are not associated with variants in common candidate genes. Lipids. 52, 969-980
44. Su, H. M., and Brenna, J. T. (1998) Simultaneous measurement of desaturase activities using stable isotope tracers or a nontracer method. Anal. Biochem. 261, 43-50
45. Valenzuela, R., Barrera, C., Gonzalez-Astorga, M., Sanhueza, J., and Valenzuela, A. (2014) Alpha linolenic acid (ALA) from Rosa canina, sacha inchi and chia oils may increase ALA accretion and its conversion into n-3 LCPUFA in diverse tissues of the rat. Food Funct. 5, 1564-1572
46. Giuliano, V., Lacombe, R. J. S., Hopperton, K. E., and Bazinet, R. P. (2018) Applying stable carbon isotopic analysis at the natural abundance level to determine the origin of docosahexaenoic acid in the brain of the fat-1 mouse. Biochim. Biophys. Acta Mol. Cell Biol. Lipids. 1863, 1388-1398
47. Lacombe, R. J. S., Giuliano, V., Colombo, S. M., Arts, M. T., and Bazinet, R. P. (2017) Compound-specific isotope analysis resolves the dietary origin of docosahexaenoic acid in the mouse brain. J. Lipid Res. 58, 2071-2081
48. Domenichiello, A. F., Chen, C. T., Trepanier, M. O., Stavro, P. M., and Bazinet, R. P. (2014) Whole body synthesis rates of DHA from alpha-linolenic acid are greater than brain DHA accretion and uptake rates in adult rats. J. Lipid Res. 55, 62-74
49. DeNiro, M. J., and Epstein, S. (1977) Mechanism of carbon isotope fractionation associated with lipid synthesis. Science. 197, 261-263
50. Gregory, M. K., Gibson, R. A., Cook-Johnson, R. J., Cleland, L. G., and James, M. J. (2011) Elongase reactions as control points in long-chain polyunsaturated fatty acid synthesis. PLoS One. 6, e29662
51. Wang, Y., Botolin, D., Christian, B., Busik, J., Xu, J., and Jump, D. B. (2005) Tissue-specific, nutritional, and developmental regulation of rat fatty acid elongases. J. Lipid Res. 46, 706-715
52. Pauter, A. M., Olsson, P., Asadi, A., Herslof, B., Csikasz, R. I., Zadravec, D., et al. (2014) Elov12 ablation demonstrates that systemic DHA is endogenously produced and is essential for lipid homeostasis in mice. J. Lipid Res. 55, 718-728
53. Metherel, A. H., and Bazinet, R. P. (2019) Updates to the n-3 polyunsaturated fatty acid biosynthesis pathway: DHA synthesis rates, tetracosahexaenoic acid and (minimal) retroconversion. Prog. Lipid Res. 76, 101008
54. Bazinet, R. P., Weis, M. T., Rapoport, S. I., and Rosenberger, T. A. (2006) Valproic acid selectively inhibits conversion of arachidonic acid to arachidonoyl-CoA by brain microsomal longchain fatty acyl-CoA synthetases: relevance to bipolar disorder. Psychopharmacology (Berl.). 184, 122-129
55. Gotoh, N., Nagao, K., Ishida, H., Nakamitsu, K., Yoshinaga, K., Nagai, T., et al. (2018) Metabolism of natural highly unsaturated fatty acid, tetracosahexaenoic acid (24:6n-3), in C57BL/KsJ-db/ db mice. J. Oleo Sci. 67, 1597-1607
56. Liu, L., Hu, Q., Wu, H., Wang, X., Gao, C., Chen, G., et al. (2018) Dietary DHA/EPA ratio changes fatty acid composition and attenuates diet-induced accumulation of lipid in the liver of ApoE(-/-) mice. Oxid. Med. Cell Longev. 2018, 6256802
57. Alsaleh, A., Maniou, Z., Lewis, F. J., Hall, W. L., Sanders, T. A., and O’Dell, S. D. (2014) ELOVL2 gene polymorphisms are associated with increases in plasma eicosapentaenoic and docosahexaenoic acid proportions after fish oil supplement. Genes Nutr. 9, 362
58. Pan, G., Cavalli, M., Carlsson, B., Skrtic, S., Kumar, C., and Wadelius, C. (2020) rs953413 regulates polyunsaturated fatty acid metabolism by modulating ELOVL2 expression. iScience. 23, 100808
59. Pal, A., Metherel, A. H., Fiabane, L., Buddenbaum, N., Bazinet, R. P., and Shaikh, S. R. (2020) Do eicosapentaenoic acid and docosahexaenoic acid have the potential to compete against each other? Nutrients. 12, 3718
60. Le, V. T., Knight, S., Watrous, J. D., Najhawan, M., Dao, K., McCubrey, R. O., et al. (2023) Higher docosahexaenoic acid levels lower the protective impact of eicosapentaenoic acid on longterm major cardiovascular events. Front. Cardiovasc. Med. 10, 1229130
61. ASCEND Study Collaborative Group, Bowman, L., Mafham, M., Wallendszus, K., Stevens, W., Buck, G., et al. (2018) Effects of n-3 fatty acid supplements in diabetes mellitus. N. Engl. J. Med. 379, 1540-1550
62. Manson, J. E., Cook, N. R., Lee, I. M., Christen, W., Bassuk, S. S., Mora, S., et al. (2019) Marine n-3 fatty acids and prevention of cardiovascular disease and cancer. N. Engl. J. Med. 380, 23-32
63. Bhatt, D. L., Steg, P. G., Miller, M., Brinton, E. A., Jacobson, T. A., Ketchum, S. B., et al. (2019) Cardiovascular risk reduction with icosapent ethyl for hypertriglyceridemia. N. Engl. J. Med. 380, 11-22
64. Yokoyama, M., Origasa, H., Matsuzaki, M., Matsuzawa, Y., Saito, Y., Ishikawa, Y., et al. (2007) Effects of eicosapentaenoic acid on major coronary events in hypercholesterolaemic patients
(JELIS): a randomised open-label, blinded endpoint analysis. Lancet. 369, 1090-1098
65. Firth, J., Teasdale, S. B., Allott, K., Siskind, D., Marx, W., Cotter, J., et al. (2019) The efficacy and safety of nutrient supplements in the treatment of mental disorders: a meta-review of metaanalyses of randomized controlled trials. World Psychiatry. 18, 308-324
  1. *For correspondence: Adam H. Metherel, adam.metherel@utoronto.ca.

Journal: Journal of Lipid Research, Volume: 65, Issue: 6
DOI: https://doi.org/10.1016/j.jlr.2024.100548
PMID: https://pubmed.ncbi.nlm.nih.gov/38649096
Publication Date: 2024-04-21

Dietary docosahexaenoic acid (DHA) downregulates liver DHA synthesis by inhibiting eicosapentaenoic acid elongation

Adam H. Metherel , Rodrigo Valenzuela , Brinley J. Klievik , Giulia Cisbani ® , Ruxandra D. Rotarescu , Melissa Gonzalez-Soto , Céline Cruciani-Guglielmacci , Sophie Layé , Christophe Magnan , David M. Mutch , and Richard P. Bazinet Department of Nutritional Sciences, University of Toronto, Toronto, ON, Canada; Department of Nutrition, University of Chile, Santiago, Chile; Department of Human Health and Nutritional Sciences, University of Guelph, Guelph, ON, Canada; BFA, UMR8251, CNRS, Université Paris Cité, Paris, France; and INRA, Bordeaux INP, NutriNeuro, Université de Bordeaux, Bordeaux, France

Abstract

DHA is abundant in the brain where it regulates cell survival, neurogenesis, and neuroinflammation. DHA can be obtained from the diet or synthesized from alpha-linolenic acid (ALA; 18:3n-3) via a series of desaturation and elongation reactions occurring in the liver. Tracer studies suggest that dietary DHA can downregulate its own synthesis, but the mechanism remains undetermined and is the primary objective of this manuscript. First, we show by tracing content ( ) of DHA via compoundspecific isotope analysis, that following low dietary DHA, the brain receives DHA synthesized from ALA. We then show that dietary DHA increases mouse liver and serum EPA, which is dependant on ALA. Furthermore, by compound-specific isotope analysis we demonstrate that the source of increased EPA is slowed EPA metabolism, not increased DHA retroconversion as previously assumed. DHA feeding alone or with ALA lowered liver elongation of very long chain (ELOVL2, EPA elongation) enzyme activity despite no change in protein content. To further evaluate the role of ELOVL2, a liver-specific Elovl2 KO was generated showing that DHA feeding in the presence or absence of a functional liver ELOVL2 yields similar results. An enzyme competition assay for EPA elongation suggests both uncompetitive and noncompetitive inhibition by DHA depending on DHA levels. To translate our findings, we show that DHA supplementation in men and women increases EPA levels in a manner dependent on a SNP (rs953413) in the ELOVL2 gene. Fir In conclusion, we identify a novel feedback inhibition pathway where dietary DHA downregulates its liver synthesis by inhibiting EPA elongation.

Supplementary key words dietary fat kinetics liver nutrition – omega-3 fatty acids – enzyme inhibition – polyunsaturated fatty acid – fatty acid metabolism – elongation of very long-chain
The brain is enriched with the omega-3 (n-3) PUFA, DHA, where it either directly or upon conversion to a series of bioactive metabolites, regulates several important aspects of brain function (1, 2). DHA is a precursor to both n -docosahexaenoylethanolamine (synaptamide) and oxylipins, including the specialized proresolving lipid mediators which have been shown to affect neurodevelopment (3, 4), inflammation (5-7), and cell survival . The brain can either obtain DHA from the diet directly or after desaturation and elongation of its 18-carbon essential PUFA precursor, alphalinolenic acid (ALA, 18:3n-3). While many tissues have the capacity to synthesize DHA, their ability to do so is generally considered low, especially within the brain, and they rely on synthesis of DHA from the liver (10-13). Interestingly, the liver, but not the brain, can upregulate DHA synthesis in response to low dietary DHA, albeit the mechanism is not known (14, 15). Furthermore, since 1985 (16), DHA supplementation has been widely observed to increase EPA levels in humans (16-24) and rodents (25-32), and this response was believed to be the result of an increased flux though the retroconversion pathway discovered in 1969 (33) that involves partial -oxidation of DHA in the peroxisomes to form EPA.
Compound-specific isotope analysis (CSIA) has emerged as a valuable tool for the investigation of nutrition and metabolism and has recently been reviewed (34). Briefly, abundance ( ) in plants varies naturally depending on the photosynthetic pathways present, with C4 photosynthetic plants (i.e., sugar cane and corn) having higher values than C3 photosynthetic plants (i.e., flax and canola), with the
latter making up the vast majority of all plant species (35). These natural variations in of nutrients-including fatty acids-of plants and the tissues of animals consuming them are what enables CSIAdriven nutrition and metabolic studies via high precision GC-combustion-isotope ratio mass spectrometry ( C IRMS). Using CSIA, we recently demonstrated that the previously accepted mechanisms explaining the increase of EPA with DHA supplementation was inaccurate (24). Specifically, young adults were supplemented with day of DHA containing high C-DHA levels 0.2 , milliUrey ( mUr ) SEM) relative to low baseline plasma levels in the participants. As expected, DHA supplementation increased plasma EPA concentrations by over 12 weeks; however, levels did not change from baseline ( ) to post supplementation ( ) suggesting that ALA, with a baseline plasma -ALA of , was contributing to the rise in DHA. This translational work supported a previous study in which Long-Evans rats fed either an ALA + DHA diet or an ALA only diet for 8 weeks demonstrated no differences in liver values ( and , respectively) despite the significantly higher values of DHA in the diet of .
Collectively, this novel finding that ALA is a metabolic source for the higher EPA in human plasma and rat liver following DHA intake suggests a slowing of EPA metabolism. In this study, we aim to identify if the mechanism for slowed EPA metabolism serves to regulate brain DHA via inhibiting DHA synthesis in the liver. In the present study, we (1) find that in response to low DHA feeding, the brain receives DHA synthesized from ALA, (2) feed ALA, DHA, or ALA + DHA to WT (BALB/c), as well as control, and liver-specific elongation of very long chain 2 (Elovl2) KO mice (C57Bl/6J), to demonstrate that DHA combined with ALA is required to increase EPA in a manner indicative of ELOVL2 inhibition, (3) use an enzyme competition assay to demonstrate the uncompetitive and noncompetitive inhibition by DHA on elongation of EPA, and (4) perform a secondary analysis on human plasma from DHA supplemented men and women to identify a SNP in that results in a larger increase in EPA levels following DHA supplementation. Collectively this work identifies that EPA elongation in the liver is downregulated by dietary DHA to inhibit DHA synthesis.

MATERIALS AND METHODS

Ethics statement

All animal protocols and procedures were performed in alignment with the policies of the Canadian Council on Animal Care and were approved by the University of Toronto Animal Ethics Committee. The human randomized control trial was approved by the Human Research Ethics Board at the University of Guelph, abides by the Declaration of
Helsinki principles and was registered at clinicaltrials.gov (NCT03378232).

Study design

Mouse feeding study. Twenty-four 28-day-old male BALB/c mice were ordered from Charles River Laboratories (St. Constance, QC) and placed on ALA in total fat diet (ALA) for 4 weeks. After this initial 4 weeks of ALA feeding, mice were placed on one of the three diets for an additional 4 weeks: (1) maintained on the ALA diet, (2) switched to a DHA in total fat (DHA) diet, or (3) switched to a ALA DHA in total fat (ALA + DHA) diet. All diets were modified from the AIN-93G custom low n-3 PUFA diets (Dyets, Inc, Bethlehem, PA) used previously (31, 36-38). The diets contained lipids by weight consisting of safflower oil, hydrogenated coconut oil, and added oils (a combination of ALA, DHA, and oleate ethyl esters) purchased from Nu-Chek Prep, Inc (Elysian, MN). The individual ALA and DHA diets also contained oleate ethyl ester to balance the additional n-3 PUFA present in the ALA + DHA diet.
Diet fatty acid compositions were determined by GC-flame ionization detection (FID) to contain ALA (ALAonly diet), DHA in the DHA-only diet, and 0.01 ALA and DHA in the ALA + DHA diet. Furthermore, values were determined by GC-C-IRMS to be for ALA, for DHA, and for ALA and for DHA in the ALA, DHA and ALA + DHA diets, respectively (see supplemental Table Sl for complete fatty acid composition). At 12 weeks of age and following the 8 -week feeding period, mice were anesthetized under isoflurane, blood was collected by cardiac puncture, and animals were perfused with cold phosphate-buffered saline into the left ventricle. Serum and livers were collected and immediately frozen on dry ice before storage at prior to determining fatty acid levels, gene expression, protein content and enzyme activity.
Liver-specific Elovl2 KO mouse feeding study. Six C57Bl/6J mice (two males and four females) were received from the Université Paris Cité. All mice were floxed (lox/lox) for the Elovl2 gene, with male mice expressing Cre (+/-) in the liver under albumin promotor, and female mice not expressing Cre (-/-). Liver Elovl2 KO specificity was confirmed by gene expression prior to shipment in comparison to kidney Elovl2 expression. Upon arrival at the University of Toronto, mice were quarantined for approximately 2 weeks and then harem bred (one male and two females per harem). At weaning (21 days), pups were genotyped for Cre and at 28-days old pups were placed onto the same 8 -week dietary feeding protocol described for the BALB/c mouse feeding study. After 8 weeks of feeding, male mice were perfused, and serum, brains, and livers were collected and stored as described above for the BALB/c mice. Mice from the same litters were placed in different dietary groups by genotype with mice negative for included as the control group.
Enzyme competition study. Eight-week-old male BALB/c mice were ordered from Charles River Laboratories and placed on a standard Teklad 2918 chow diet (Envigo, Indianapolis, IN) for 6 weeks. As reported previously, fatty acid composition of the diet, as % weight in total fatty acids was 6.2% ALA, , and (39). Following 6 weeks, 12 -week-old mice were perfused with cold-
saline and livers collected as described above for future analysis of liver enzyme activity for the conversion of EPA to n-3 docosapentaenoic acid (DPAn-3, 22:5n-3) (ELOVL2/5).
Human DHA supplementation study. Human plasma samples from males and females ( and 14, respectively) of a previously published randomized control trial were used to assess the role of the rs953413 (ELOVL2) and rs174537 fatty acid desaturase 1 (FADS1) SNP on changes in EPA levels following 12 weeks supplementation with day of fish oil derived DHA triglycerides ( purity). Small amounts of n-3 PUFA impurities were present in the form of ALA, EPA, and DPAn-3, while all other impurities were saturates ( ), monounsaturates ( ) or linoleic acid ( ) (24). Methodological and participant information has been reported in detail previously .

Fatty acid analyses

Lipid extraction and preparation of fatty acid methyl esters. Lipids were extracted from of human plasma, of mouse serum, and 50 mg of mouse brain and liver in chloroform:methanol by a modified Folch method (41). Docosatrienoic acid (22:3n-3) ethyl ester (Nu-Chek Prep) was included at 10,5 , and , respectively, as internal standard for fatty acid quantification. After homogenization, lipid and aqueous phases were separated with the addition of , centrifuged at for 5 min , and the bottom lipidcontaining chloroform phase was isolated. The resulting total lipid extracts for plasma/serum and an aliquot of the liver total lipid extracts were dried under a stream of nitrogen and transesterified with boron trifluoride in methanol for 1 h at . The samples were cooled to room temperature, 1 ml of water and hexane were added, vortexed, and centrifuged at for 5 min . The top hexane layer containing fatty acid methyl esters (FAMEs) were isolated, dried under nitrogen, resuspended in 100-200 of heptane, analyzed by GC-FID, recapped, and subsequently analyzed by GC-C-IRMS.
Gas chromatography. FAMEs generated from human plasma were analyzed on a Varian 430 GC-FID (SCION Instruments, Goes, NL) equipped with a SP-2560 i.d. film thickness capillary column (MilliporeSigma, Burlington, MA), as previously described (24, 37). FAMEs generated from mouse serum, brain, and liver were analyzed on the same GC-FID, equipped instead with a DB-FFAP i.d. film thickness capillary column (J&W Scientific from Agilent Technologies, Mississauga, ON). FAMEs ( ) were introduced into the GC-FID by a Varian CP-8400 autosampler into the injector heated at with a split ratio of . Initial oven temperature was with a 1.0 min hold followed by a ramp to , a ramp to , a ramp to with a 9.5 min hold, and then a ramp up to with an 11.1 min hold at the end. The FID temperature was with air and helium make-up gas flow rates of 300 and , respectively, and a sampling frequency of 40 Hz . Peaks were identified by retention times through comparison to an external mixed standard sample (GLC-462, Nu-Chek Prep).
FAMEs generated from mouse serum, brain, and liver were analyzed for carbon-13 content ( ) on a Thermo MAT253 C-IRMS (Thermo Fisher Scientific, Bremen, Germany), injected by a TriPlus RSH autosampler onto a SP-2560 capillary column affixed to a Trace 1310 GC. Fatty acids enter the combustion reactor and are quantitatively combusted to ,
which enters the MAT253 IRMS via a ConFlo IV continuous flow interface providing the of the , and therefore the FAME of interest. All additional methodological details relevant to analysis, such as analysis, reporting of values, isotopic normalization, and methyl group corrections are as previously described in detail .

Gene and enzyme analyses

Liver-specific Elovl2 KO mouse genotyping. DNA from the ear punches collected from weaned mice at 21 days were extracted with REDExtract-N-Amp Tissue PCR Kit (MilliporeSigma). Briefly, of extraction solution and of tissue preparation solution were added to ear punches, vortexed, incubated at room temperature for 10 min , and at for 3 min . Samples were removed from heat, of neutralization solution immediately added and vortexed. DNA extracts were then stored at until further analysis. DNA was amplified using the FastStart Taq DNA Polymerase kit (Roche Diagnostics, Mississauga, ON). Briefly, each sample/reagent mixture for amplification included water, PCR reaction buffer with , dNTP nucleotide mix, Taq DNA polymerase, each of GATGGCAAACATACGCAAGG, R-5′ CCCTGAACATGTCCATCAGG) and -actin (F-5′ GCCTCAT GCCATTCTACGAC, R-5′ CGAATACTTGCGTTCTGGGG) forward and reverse primers, and of extracted DNA material. Using the Biometra Professional Gradient System (Montreal Biotech Inc, Kirkland, QC), the PCR mixtures were then incubated at for 4 min , followed by 40 cycles of for for 0.5 min , and for 1.0 min , and a final hold at for 7 min to amplify the Cre and -actin target and positive control genes, respectively. To each mixture, of Safe-Green fluorescent dye (Abcam, Cambridge, UK) was added, mixed, and was added to agarose gel wells and run by gel electrophoresis for 45 min at 100 V . Agarose gels were visualized under UV light for Cre ( 386 bp) and -actin ( 502 bp) bands in relation to bp reference DNA ladder (FroggaBio, Concord, ON) (supplemental Fig. S1).
Human genotyping. DNA was extracted from whole blood using the Qiagen PAXgene Blood DNA kit (Qiagen, Toronto, ON) and genotyping performed using the Sequenom MassArray platform, as previously described (42, 43). The genotypes for SNP rs953413 (ELOVL2) and rs174537 (FADS1) were identified for all participants. Deviations from HardyWeinberg equilibrium were tested for each SNP for all participants and within male and female groups using a Chisquare test. As previously reported (42), five samples were selected randomly for replication with accordance achieved.
Liver gene expression and protein masses of BALB/c mice. Total RNA was extracted using TRIzol Reagent (Invitrogen, Massachusetts, USA) for tissue homogenization and the RNeasy Mini Kit (Qiagen, Mississauga, ON, CA), as per manufacturer’s instructions. RNA concentration and purity were determined using a NanoDrop Spectrophotometer (Thermo Fisher Scientific, Wilmington, USA). Only samples with sufficient RNA concentration and purity ratios ( and ) between 1.8 and 2.2 were used for gene expression analyses. One microgram of total RNA was used to synthesize cDNA using the Applied Biosystems High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific), as per
manufacturer’s instructions. Reverse transcriptionquantitative PCR (RT-qPCR) was conducted on a Bio-Rad CFX96 Real-Time system. The primers used for RT-qPCR were designed online using the Roche Universal Probe Library and Assay Design Center. A total reaction volume per sample ( ) was made, consisting of SsoFast Evagreen Supermix (Bio-Rad Laboratories), cDNA template, of forward and reverse primer mixture, and nuclease-free water. The following cycling conditions were used: one denaturing cycle at for 30 s , followed by 40 cycles of for 4 s and for 4 s . All reactions were run in triplicate. Subsequently, 18 S was used as a housekeeping gene for normalization. Results were quantified using the method.
Protein masses ( ) of FADS2, FADS1, ELOVL2, and ELOVL5 enzymes were determined by commercially available sandwich enzyme-linked immunosorbent assay kits (MyBioSource, Inc, San Diego, CA, USA) according to the manufacturer’s instructions. Briefly, of diluted liver homogenate was added to sample wells, the plates were sealed and then incubated at for 90 min . The plates were then washed, biotin-labeled antibody added to the wells, incubated at for 60 min and then washed. HRP-streptavidin conjugate was then added, incubated, and washed. 3,3′,5,5′-tetramethylbenzidine substrate was then added, incubated at for , the reaction stopped, and absorbance was read at 450 nm and compared to a standard curve.
Liver enzyme activities of mice. Perfused livers from the BALB/c mouse feeding study frozen on dry ice ( ) were homogenized in a buffer solution pH 7.9 containing Hepes, EDTA, Nonidet P-40, , and protease inhibitors ( phenylmethylsulfonyl fluoride, aprotinin, leupeptin, and orthovanadate). Liver homogenates were centrifuged at , first at for 30 s , followed by centrifugation of the supernatants at for 5 min , and finally at for 60 min , to obtain the microsomal fractions for the assessment of desaturase and elongase activities.
Desaturase and elongase activities were assayed using 1 ml of incubation medium containing ATP, coenzyme-A, NADPH, -acetylcysteine, nicotinamide, , and phosphate buffer pH 7 , added with 100 nmol albumin-bound n-3 PUFA precursor and 1 mg protein of cytosolic extract to a final total reaction mixture volume of 2 ml incubated at for 30 min with shaking. Each reaction represents the equivalent of between 60 and 80 mg of liver tissue. When determining elongase activity, 5 mmol of malonyl-CoA was included in the reaction mixture. FADS2 enzyme activity was determined by the amount of 18:3n-3 (ALA) converted to (SDA), FADS1 activity by the amount of (ETA) converted to , ELOVL2 activity by the amount of 22:5n-3 (DPAn-3) converted to (n-3 tetracosapentaenoic acid), ELOVL5 activity by the amount of 18:4n-3 converted to 20:4n-3 (ETA), and ELOVL2/5 activity by the amount of converted to (44).
Each specific reaction was stopped by adding 6 ml of a chloroform:methanol mixture ( ). Heptadecanoic acid (17:0; purity ) was added ( ) as internal standard. To determine the levels of products or precursors achieved after incubation, lipids were extracted and derivatized to FAME and levels determined by GC-FID, as described earlier. From GC-FID results, desaturase and elongase enzyme activities
were measured as net increase of n-3 PUFA product produced from precursor n-3 PUFA, calculated from the differences between baseline values prior to incubation and those obtained after 30 min incubation. Results are expressed as protein (45).
Enzyme competition assay by DHA for the ELOVL2/5 conversion of EPA to DPAn-3. To determine the effect of DHA on the ELOVL2/5 reaction activity ( conversion to ) we performed the same microsomal isolation and enzyme activity reaction described previously in mice for the enzyme competition study. The enzyme competition assays were prepared using DHA as the inhibitor at different concentrations , and ) in the presence of EPA, the elongase reaction precursor, at different concentrations ( 0,50 , 100,150 , and ). The ELOVL2/5 product (22:5n-3) concentrations as a result of the reaction, were determined as protein and used to generate Michaelis-Menten curves. To evaluate the effect of DHA in comparison to a control fatty acid, palmitic acid (16:0) and DHA were compared as inhibitors of ELOVL2/5 at increasing concentrations of both fatty acids ( , and ) in the presence of EPA.
Statistical analyses. ANOVAs and accompanying Tukey’s post hoc tests were performed with IBM Statistics 24 software (IBM, Armonk, NY, https://www.ibm.com/products/spssstatistics). Data that were not normally distributed as determined by the Shapiro-Wilk test were log transformed prior to ANOVA analysis. Michaelis-Menten curves for the enzyme competition assay were developed using GraphPad Prism 9.1 (GraphPad Software, San Diego, CA, https://www.graphpad. com/). Significance for all statistical analysis was determined at . All data are presented as means SEM.

RESULTS

Brain DHA concentrations and levels from control mice fed ALA, DHA, or ALA + DHA diets

In order to test how the brain obtains DHA when DHA is absent or present in the diet, the control Elovl2 KO mice underwent 4 weeks of feeding an ALA only diet followed by an additional 4 weeks of feeding the ALA only, DHA only, and ALA + DHA diets. Tukey’s post hoc analysis did not result in any significant differences ( ) in the brain DHA concentrations and , respectively) following a significant one-way ANOVA ( ) (Fig. 1A). However, brain -DHA levels were significantly different between all groups with DHA only ALA + DHA ALA only diets (Fig. 1B).

Serum and liver n-3 PUFA concentrations of BALB/c mice fed ALA, DHA, or ALA + DHA

Following 4 weeks of feeding an ALA only diet to BALB/c mice and then maintaining animals on the ALA diet or switching to a DHA only or ALA + DHA diet for another 4 weeks, animals were perfused,
Fig. 1. Brain DHA (A) concentrations and (B) carbon-13 levels ( ) of control mice fed an ALA only, DHA only and ALA + DHA diet. Normality was determined by Shapiro-Wilk test for normality and nonnormally distributed data were log transformed prior to further statistical analysis. Different letters (a, b , and c ) represent statistically significant differences ( ) between diets and were determined by one-way ANOVA followed by a Tukey’s HSD post hoc test. All values are reported in means SEM ( ). , carbon-13 abundance; ; ALA, -linolenic acid, 18:3n-3; DHA, docosahexaenoic acid, 22:6n-3; HSD, honestly significant difference.
and serum (Fig. 2A) and liver (Fig. 2B) n-3 PUFA levels determined. In both tissues, ALA levels were higher ( ) in mice fed the two ALAcontaining diets compared to the DHA only diet that was devoid of ALA. Similarly, DHA levels in both tissues were higher ( ) in the two DHAcontaining diets compared to the ALA only diet devoid of DHA. Most importantly, EPA levels were higher ( in serum SEM and liver of mice fed the ALA + DHA diet for compared to the ones fed ALA only ( 24.5 and , respectively) and DHA only diet and , respectively), suggesting that both ALA and DHA are necessary for the increase in EPA.

Serum and liver n-3 PUFA carbon-13 content of BALB/c mice fed ALA, DHA, or ALA + DHA

In addition to serum fatty acid concentrations in BALB/c mice (Fig. 2), the of ALA, EPA, and DHA
Fig. 2. N-3 PUFA concentrations in male BALB/c mice fed 4 weeks of: (1) ALA only (ALA), (2) DHA only (DHA) or (3) ALA + DHA diets following a 4 -week ALA run-in diet. A: Serum and (B) liver. Normality was determined by ShapiroWilk test for normality and nonnormally distributed data was log transformed prior to further statistical analysis. Different letters (a, b, and c) represent statistically significant differences ( ) between diets for a specific fatty acid and were determined by one-way ANOVA followed by a Tukey’s HSD post hoc test. All values are reported in means SEM ( ). ALA, -linolenic acid, 18:3n-3; DHA, docosahexaenoic acid, 22:6n-3; DPAn-3, n-3 docosapentaenoic acid, 22:5n-3; EPA, eicosapentaenoic acid, 20:5n-3; HSD, honestly significant difference.
in serum (Fig. 3A-C) and liver (Fig. 3D-F) were determined to identify the sources of each, either synthesis from ALA or from preformed DHA. ALA levels (mUr SEM) in serum were not different between the ALA and ALA + DHA ( ) fed mice, with both lower than the DHA only fed mice 0.7 mUr ). Liver -ALA was different ( ) between all three diet groups where DHA ( levels between the ALA and ALA + DHA fed mice in both serum ( and , respectively) and liver ( 1.6 and , respectively) were not different ( ). However, was significantly higher in the serum
Fig. 3. ALA, EPA, and DHA carbon-13 levels ( ) of male BALB/c mice fed 4 weeks of (1) ALA only (ALA), (2) DHA only (DHA) or (3) ALA + DHA diets following a 4-week ALA run-in diet. A: serum ALA, (B) serum EPA, (C) serum DHA, (D) liver ALA, (E) liver EPA, and (F) liver DHA. Normality was determined by Shapiro-Wilk test for normality and nonnormally distributed data were log transformed prior to further statistical analysis. Different letters (a, b, and c) represent statistically significant differences ( ) between diets and were determined by one-way ANOVA followed by a Tukey’s HSD post hoc test. All values are reported in means SEM ( ). , carbon-13 abundance; , mean of ALA and ALA +DHA diets; (mUr) of DHA and ALA+DHA diets; ALA, -linolenic acid, 18:3n-3; DHA, docosahexaenoic acid, 22:6n-3; EPA, eicosapentaenoic acid, 20:5n-3; HSD, honestly significant difference.
and liver ( ) of DHA only group compared to either ALA fed group, revealing that DHA becomes a significant source of EPA only in the absence of ALA. Similar finding were also shown for C-DPAn-3 (supplemental Fig. S2). Serum -DHA levels were significantly different between all diets (DHA ALA + DHA ALA; and , respectively), and liver -DHA following DHA ( ) and ALA + DHA feeding were significantly higher ( ) than following ALA feeding ( ).

Liver gene expression, protein content, and enzyme activity of BALB/c mice fed ALA, DHA, or ALA + DHA diets

mRNA expression, protein levels, and enzyme activity (Fig. 4A-C) were measured in the livers of the ALA, DHA, or ALA + DHA fed mice. Elovl2 mRNA was lower in the DHA group compared to the ALA group ( ), and Elovl5 was lower in the DHA group compared to ALA group ( ) (Fig. 4A). Elovl2 and Elovl5 expression in the ALA + DHA group was not different from ALA or DHA fed mice ( ). Furthermore, Fads 2 mRNA levels were lower in the DHA and lower in the ALA + DHA group compared to the ALA group ( ). There were no differences in mRNA expression for any gene when comparing DHA and ALA + DHA fed mice ( ). No differences were detected in Fads1 mRNA between the three groups.
DHA only and ALA + DHA feeding resulted in lower FADS2 and SEM, respectively) and FADS1 ( and , respectively) protein content compared to FADS2 ( ) and FADS1 ( ) levels in the ALA only fed animals. Protein content of ELOVL2 and ELOVL5 did not differ ( ) between any dietary groups (Fig. 4B).
Liver enzyme activity ( protein SEM) was measured in isolated liver microsomes and determined by the rate of conversion of an exogenously supplied precursor to its product (Fig. 4C). Compared to the ALA only fed animals for FADS2, 0.077 for FADS1 and for ELOVL2) the enzyme activity was lower for FADS2 ( and ), FADS1 ( and ), and ELOVL2 ( and ) for both the DHA-only and ALA + DHA fed mice, respectively. No differences ( ) in enzyme activity were identified between dietary protocols for ELOVL5 or the ELOVL2/5 reaction (EPA DPAn-3).

Serum and liver n-3 PUFA levels of liver-specific Elovl2 KO mice fed ALA, DHA, or ALA + DHA diets

Similar to the feeding study in BALB/c mice, following 4 weeks of feeding an ALA only diet to liverspecific Elovl2 KO and control mice and then maintaining animals on the ALA diet or switching to a DHA only or ALA + DHA diet for another 4 weeks, animals were euthanized, and serum (Fig. 5A) and liver (Fig. 5B) fatty acid levels determined. A statistically significant interaction effect (genotype diet) was observed for
Fig. 4. Liver gene expression, protein content, and enzyme activity in male BALB/c mice fed 4 weeks of (1) ALA only (ALA), (2) DHA only (DHA) or (3) ALA + DHA diets following a 4-week ALA run-in diet. A: mRNA expression, (B) protein content, (C) enzyme activity and (D) n-3 PUFA biosynthesis pathway with enzymes. Normality was determined using a Shapiro-Wilk test and nonnormally distributed data were log transformed prior to further statistical analysis. Different letters ( , and c ) represent statistically significant differences ( ) between diets for a gene, protein or enzyme activity were determined by one-way ANOVA followed by a Tukey’s HSD post hoc test. All values are reported in means SEM ( ). ALA, -linolenic acid, 18:3n-3; DHA, docosahexaenoic acid, 22:6n-3; Elovl, elongation of very long chain; Fads, fatty acid desaturase; HSD, honestly significant difference.
liver EPA, DPAn-3, and DHA ( ) and for serum ALA, EPA, and DPAn-3 ( SEM). Specifically, liver and serum EPA in the control animals were similar between the ALA only and DHA only fed animals, and the EPA levels in the ALA + DHA fed animals were higher ( ) than both other diets. Furthermore, liver EPA was higher in the ALA only fed KO mice ( ) compared to control ( ), with no liver EPA differences between genotypes for the DHA only ( 0.04 and , respectively) or ALA + DHA fed animals ( and , respectively). In serum, EPA levels were higher in the KO mice of ALA-only ( ) and ALA +
DHA fed ( ) animals compared to control animals ( and , respectively). In liver and serum, DPAn-3 levels were higher in the KO animals of either DHA-fed groups, but higher in the ALA only fed group compared to controls. Finally, liver DHA levels were lower in the KO animals compared to controls in the ALA-only group ( vs. , respectively) and the ALA + DHA group ( vs. , respectively), and serum DHA levels yielded a main effect of genotype where DHA was lower in the KO animals ( ) compared to controls ( ).
Fig. 5. N-3 PUFA concentrations in male liver-specific Elovl2 KO and control mice fed 4 weeks of: (1) ALA only (ALA), (2) DHA only (DHA) or (3) ALA + DHA diets following a 4-week ALA run-in diet. A: serum and (B) liver. Normality was determined using a Shapiro-Wilk test and nonnormally distributed data were log transformed prior to further statistical analysis. Significant interaction and main effects of genotype and diet were determined by two-way ANOVA. Main effects of diet were further assessed by Tukey’s post hoc test. As a result of a significant interaction effect, different letters (a, b, and c) represent statistically significant differences ( ) between diets for a specific fatty acid within genotype as determined by one-way ANOVA followed by a Tukey’s HSD post hoc test, and (*) represents statistically significant differences for a specific fatty acid between genotypes and within a diet as determined by independent test. For serum DHA, represents a main effect of diet where ALA DHA ALA + DHA and represents a main effect of genotype where CTL KO. All values are reported in means SEM ( ). ALA, -linolenic acid, 18:3n-3; DHA, docosahexaenoic acid, 22:6n-3; DPAn-3, n-3 docosapentaenoic acid, 22:5n-3; Elovl2, elongation of very long chain 2; EPA, eicosapentaenoic acid, 20:5n-3; HSD, honestly significant difference.

Serum and liver n-3 PUFA carbon-13 content of liver-specific Elovl2 KO mice fed ALA, DHA, or ALA + DHA

Serum (Fig. 6A-C) and liver (Fig. 6D-F) C-ALA, EPA and DHA were determined for liver-specific Elovl2 KO and control mice fed ALA, DHA, or ALA + DHA diets for 4 weeks following a 4-week ALA only diet. There were no effects of genotype on serum or liver -ALA, or . Significant main effects of diet were determined for serum ALA ( ), serum , serum C-DHA , liver -ALA , liver , and liver . In both the serum and liver, -ALA was higher in the DHA only group and SEM, respectively) compared to both the ALA group
and , respectively) and the ALA + DHA group ( and , respectively), with the ALA and ALA + DHA groups not different . In both the serum and liver, C-EPA was highest in the DHA only diet and , respectively), followed by the ALA + DHA diet and , mUr, respectively) and the ALA only diet ( and mUr , respectively). In both the serum and liver, DHA was higher in the DHA only and ALA + DHA diets ( to ) compared to the ALA only diet and , respectively). Compared to serum and liver , a similar response for DPAn-3 was found, but with an additional small but significant genotype effect (supplemental Fig. S3).
Fig. 6. ALA, EPA, and DHA carbon- 13 levels ( ) of male liver-specific Elovl 2 KO and control mice fed 4 weeks of: (1) ALA only (ALA), (2) DHA only (DHA) or (3) ALA + DHA diets following a 4-week ALA run-in diet. A: serum ALA, (B) serum EPA, (C) serum DHA, (D) liver ALA, (E) liver EPA and (F) liver DHA. Normality was determined using a Shapiro-Wilk test and nonnormally distributed data were log transformed prior to further statistical analysis. Significant interaction and main effects of genotype and diet were determined by two-way ANOVA. Main effects of diet were further assessed by Tukey’s post hoc test, where for serum and liver -ALA (*) represents a diet effect of (ALA , for serum and liver represents a diet effect of ALA ALA + DHA DHA and for serum and liver -DHA ( ) represents a diet effect of ALA (DHA ALA + DHA). All values are reported in means SEM ( ). , carbon-13 abundance; -ALA , mean of ALA and ALA+DHA diets; -DHA , mean (mUr) of DHA and ALA+DHA diets; ALA, -linolenic acid, 18:3n-3; DHA, docosahexaenoic acid, 22:6n-3; Elovl2, elongation of very long chain 21 EPA, eicosapentaenoic acid, 20:5n-3.

DHA inhibition of ELOVL2/5 (EPA DPAn-3) by enzyme activity competition assay

Using microsomal isolations from chow-fed BALB/c mice, a competition assay for the enzyme activity ( protein SEM) of EPA to DPAn-3 elongation (ELOVL2/5) was assessed with DHA ( 0,5 , , and ) as the inhibitor and fitted to a Michaelis-Menten model (Fig. 7A). Increasing DHA levels resulted in a decrease of from control to , and 0.012 in the presence of , and of DHA. The or the amount of substrate required to reach , were , and of EPA when in the presence of , and DHA, respectively. A separate set of liver samples were used to isolate microsomes and additional enzyme inhibition assays were performed in the presence of , and of DHA (Fig. 7B) or a palmitic acid control (Fig. 7C). ELOVL2/5 enzyme activity was significantly lower ( ) than control when exposed to ), , and of DHA, with of DHA also being significantly lower than
DHA. Conversely, ELOVL2/5 enzyme activity in the presence of and palmitic acid was not different ( ) than control ( ), but mg ) palmitic acid significantly decreased ( ) activity compared to all other levels of palmitic acid.

Change in plasma EPA levels in humans supplemented with /day of DHA for weeks

The role of sex and genetics on changes in plasma EPA levels of young women and men was assessed following 12 weeks of DHA supplementation (Fig. 8). An ELOVL2 SNP, rs953413, showed no significant interaction effect ( ), nor a significant effect of sex (Fig. 8A). However, a significant effect ) of rs953413 was identified resulting in a larger increase in plasma EPA levels for those individuals with the AA genotype ( SEM) compared to those with the GA or GG genotype . Finally, the interaction of sex with the FADS1 SNP, rs174537, was also assessed and revealed no significant interaction effects ( ) or main effects of or rs174537 ( ) (Fig. 8B).
Fig. 7. Enzyme activity assays for inhibition EPA elongation to DPAn-3 (ELOVL2/5) by DHA and palmitic acid. A: Enzyme competition assay in the presence of DHA ( per data point), and enzyme activity of elongase in the presence of , and of either (B) DHA ( ), or ( C ) palmitic acid (control, ) in isolated microsomes. Normality was determined using a Shapiro-Wilk test and nonnormally distributed data were log transformed prior to further statistical analysis. Different letters (a, b, and c) represent statistically significant differences ( ) between DHA or palmitic acid treatment levels as determined by oneway ANOVA followed by a Tukey’s HSD post hoc test. All values are reported in means SEM ( ). DHA, docosahexaenoic acid, 22:6n-3; DPAn-3, n-3 docosapentaenoic acid, 22:5n-3; EPA, eicosapentaenoic acid, 20:5n-3; HSD, honestly significant difference.

DISCUSSION

In this study, we used various models to determine the mechanism(s) by which DHA synthesis is downregulated by dietary DHA intake. These include (1) dietary studies demonstrating increases in EPA derived from both ALA and DHA in WT, and control and liverspecific Elovl2 KO mice following DHA feeding, (2) gene expression, protein content, and enzyme activity of PUFA desaturase/elongase enzymes in WT mice following DHA feeding, (3) enzyme inhibition assays in microsomal isolations to assay the elongation of EPA to DPAn-3 in the presence of DHA, and (4) a human SNP in the ELOVL2 gene in DHA supplemented adults that contributes to increased plasma EPA. This cumulation of evidence supports our previous animal (36) and human (24) studies demonstrating that the rise in EPA following dietary DHA is due to reduced downstream EPA metabolism and not increased retroconversion of DHA to EPA, and identifies elongation of EPA, in
particular by ELOVL2, as a novel and important inhibitory target of DHA via a negative feedback pathway. Collectively, our work demonstrates for the first time that dietary DHA downregulates its own synthesis in the liver by inhibiting EPA elongation.
We demonstrated no significant effects of the ALA, DHA, and ALA + DHA diets on brain DHA concentrations, but with CSIA determined that in the absence of dietary DHA the brain receives DHA synthesized from ALA, confirming our previous results in C57Bl/6J and BALB/c mice (37, 46, 47). Furthermore, the pattern for brain (DHA , Fig. 1) matches serum (Fig. 6C) and, although brain -DHA is overall lower due to a relatively slow DHA turnover rate, given enough time we expect brain -DHA to represent the -DHA supplied from serum, as previously shown (47). We then recapitulated results from prior studies in animals (25-32) and humans (16-24) demonstrating increased plasma/serum and liver EPA following DHA feeding (Fig. 2). However, EPA levels
Fig. 8. Change from baseline in plasma EPA concentrations following 12 weeks of day DHA supplementation by sex and genotype. A: rs953413 and (B) rs174537. Normality was determined using a Shapiro-Wilk test and nonnormally distributed data were log transformed prior to further statistical analysis. Statistical significance ( ) for interaction or main effects of sex and genotype were determined by two-way ANOVA. Values expressed as means SEM. For rs953413, n = 4 (AA female), 4 (AA male), 11 (GA + GG female), and 11 (GA + GG female), and for rs174537, (GG female), 8 (GG male), 7 (GT + TT female), and 7 (GG + TT male). DHA, docosahexaenoic acid, 22:6n-3; ELOVL, elongation of very long chain; EPA, eicosapentaenoic acid, 20:5n-3; FADS, fatty acid desaturase.
only increased with DHA feeding in the presence of ALA and were not different between ALA or DHA only fed animals, demonstrating that ALA is necessary to increase EPA with DHA feeding. Similarly, rats fed a ALA (in total fat) diet or a DHA diet did not differ in whole body EPA concentrations, while EPA levels in tissues of rats provided both diets were higher when compared to those provided a low ALA diet ( ) (48). However, serum/liver DPAn-3 in the DHA group was lower than either ALA group, possibly due to the presence of only one dietary source of DPAn-3 in the DHA group combined with inhibition of EPA elongation. Conversely, there is still only one DPAn-3 source in the ALA group, but the lack of inhibition allows DPAn-3 to be synthesized freely from EPA resulting in higher DPAn-3 in the ALA compared to DHA group.
The necessity of combining ALA + DHA to increase EPA provides critical information to the mechanism of EPA’s increase. Since ALA is a precursor to EPA, any increase in EPA must then be the result of slowed metabolism of ALA-derived EPA. Furthermore, we utilized high -DHA of -11.0 to -14.0 mUr compared to the flaxseed-derived -ALA of -31.2 to -34.0 mUr. This allows for identifying the source underlying EPA accumulation, either from ALA or DHA, in each of the diets. As such, liver and serum from BALB/c mice were not different between the ALA and ALA + DHA diets indicating most of the increased EPA came from ALA (Fig. 3). These results were predicted by our previous rat (36) and human (24) studies. However, although our control mice from the Elovl2 KO study show the same pattern for fatty acid levels (Fig. 5), serum, and liver -EPA levels suggest a mixed contribution of ALA and DHA (Fig. 6), discussed in more detail later. In the BALB/c mice, not until ALA is removed from the diet does increasess toward that of DHA, revealing that retroconversion rates are slow and DHA is not a major source of EPA until ALA intakes are low.
Although no known pathway exists to convert DHA to ALA, the serum and liver -ALA was higher in the DHA group suggesting the possibility of a pathway when ALA intakes are very low. Alternatively, -oxidation prefers molecules over molecules, a process known as carbon isotopic fractionation (49), which could explain the higher -ALA remaining in the body. Furthermore, although statistical analyses were not performed to compare serum and liver values, there may be a trend for lower PUFA compared to the liver, suggesting that adipose, with a DHA half-life of 5-8 days or up to 30 days from dietary DHA or ALA, respectively (37), may still be contributing to serum levels after 28 days of high DHA feeding. Although the liver -ALA (but not serum C-ALA) was unexpectedly higher in the ALA compared to ALA + DHA group, this did reflect the C-ALA differences in the diets and could again be indicative of an impact of stored adipose n-3 PUFA that differentially affects serum and liver values.
Both DHA diets reduced mRNA expression, protein content, and enzyme activity of FADS2, but only affected protein content and enzyme activity of FADS1 (Fig. 4). This suggests that although increases in DHA appear to affect the activity of both desaturase enzymes, the mechanism by which this occurs may be transcriptional for FADS2 and translational for FADS1. However, with the putative rate-limiting FADS2 reaction and the only FADS1 reaction occurring prior to EPA in the pathway, neither of these enzymes are expected to be involved in EPA accumulation with DHA feeding. Alternative to the desaturases (FADS1/2), the elongases (ELOVL2/5) contribute relatively equally to the elongation of EPA to DPAn-3 and have been identified as critical control points in the DHA
biosynthesis pathway (50). DHA compared to ALA feeding appeared to lower mRNA expression of Elovl2 and Elovl5; however, significance was not reached in the ALA + DHA group, and this lowering did not translate to lower protein content. Furthermore, DHA feeding did not affect ELOVL5 activity or the combined ELOVL2/5 activity; however, ELOVL2 activity was lower in both DHA fed groups compared to the ALA fed group. There are limitations of the enzyme activity assay: (1) microsomes are fragmented pieces of the endoplasmic reticulum that may not represent the normal structural support for the elongase and desaturase enzymes, and (2) the fatty acid composition that the isolated microsomes are exposed to may be altered compared to the intact cell. Nevertheless, we demonstrated that ELOVL2 activity is lowered independent of changes in protein content, suggesting that DHA exerts posttranslational modifications on ELOVL2, but not ELOVL5.
With the enzyme activity assay indicating ELOVL2 inhibition with increasing DHA levels, we repeated the ALA, DHA, or ALA + DHA feeding study in liverspecific Elovl2 KO and control mice to investigate how n-3 PUFA levels and compare in the presence or absence of a functional liver Elov12. Liver is the primary active tissue of the n-3 PUFA pathway and the most abundant tissue for expression of Elovl2 in rodents (51). Despite being maintained on different diets, a whole body Elovl2 KO model yielded similar serum and liver EPA and DHA patterns compared to our liverspecific Elovl2 KO (52), suggesting that a whole body Elovl2 KO is metabolically similar to knocking out the liver only. In both liver and serum of our liver-specific KOs, EPA and DPAn-3 levels were higher in the ALAfed KO mice compared to control, indicating the expected accumulation of ELOVL2 substrates as a result of liver Elovl2 KO. Elovl2 KO did not result in any additional increase in liver EPA levels following DHA or ALA + DHA feeding compared to control mice. The serum results are nearly identical to the liver, with one exception, the ALA + DHA fed KO mice displayed significantly higher serum EPA levels compared to control mice on the same diet. Furthermore, the serum -DHA pattern matches that of the brain nearly identically. Importantly, there were no interaction (diet genotype) or genotype effects for serum or liver revealing that the source of the increase in EPA of DHA-fed mice was the same in both KO and control groups. This indicates that the mechanism of the increase in EPA, KO/inhibition of elongation of EPA, may also the same. Incredibly, our results indicate that DHA feeding may have a similar effect on liver ELOVL2 activity as compared with complete liver Elovl2 KO. However, the diet effect achieved in the mice shows intermediate C-EPA levels in the ALA + DHA group, while the two DHA fed groups in the BALB/c mice are not different suggesting contribution from both ALA and DHA to the increased EPA. When
there are two sources of fatty acids, such as in our ALA + DHA diet group, the relative contribution of ALA and DHA to EPA can be calculated . As a result, we estimate that of EPA was derived from serum ALA in BALB/c mice (supplemental Fig. S4A), while of EPA was derived from serum ALA in the C57Bl/6J mice regardless of genotype (supplemental Fig. S4B). Supportive of these findings, we previously applied the same modeling to estimate the contribution of dietary ALA to liver EPA to be in Long-Evans rats on an ALA + DHA diet (36), indicating that the majority of the increase in EPA with DHA feeding is derived from ALA. Furthermore, the similarities between control and KO mice indicate that with DHA feeding less ALA is being converted past EPA and into DHA, which when combined with the brain -DHA values indicate that increased DHA shuts down its own synthesis in the liver to prevent redundancy of two brain DHA supplies.
Although our feeding studies in WT, control, and Elovl2 KO mice clearly show that EPA elongation is inhibited by DHA, the nature of this inhibition cannot be elucidated by fatty acid concentrations and values alone. Therefore, we isolated microsomes from chow-fed mice to perform a competition assay and identify how DHA ( ) is inhibiting EPA elongation to DPAn-3. The of the EPA elongation reaction decreased with each successive dosage increase in DHA, demonstrating that this is not a competitive inhibition, and DHA does not occupy the same enzymatic site as EPA. This is contrary to what we might expect to see with known ELOVL2 substrates such as DPAn-3, arachidonic acid (20:4n-6), or adrenic acid . The , which represents of the , decreased from 0 to DHA (slope ) and then plateaued from 10 to 100 mmol DHA (slope ) (Fig. 7A). Combined with decreasing (1) a decreasing reveals uncompetitive inhibition where the inhibitor binds to the enzyme after the enzymesubstrate complex has been formed to inhibit the reaction from occurring, and (2) a constant indicates noncompetitive inhibition where the inhibitor binds to the enzyme preventing the substrate from binding (54). Therefore, at low DHA levels, DHA binds to the ELOVL2 enzyme after EPA has bound to form the enzyme-substrate complex and alters ELOVL2 activity by uncompetitive inhibition. At higher DHA levels, DHA either (1) binds to the elongase prior to binding EPA, preventing EPA from binding to the active site on ELOVL2, or (2) binds to ELOVL5 adding additional, noncompetitive, inhibition of EPA elongation. Due to limitations in the enzyme affinity for EPA in this assay, supraphysiological EPA levels must be used to obtain measurable DPAn-3 product levels. Nevertheless, the relative proportions of the DHA inhibitor to EPA substrate levels in the assay (from 1:40 up to 4:1 DHA:EPA) are comparable to previously reported physiological
liver DHA:EPA proportions , although still lower than shown in our mouse livers (minimum 12:1 in the control mice).
To test our animal findings in humans, we also performed a secondary analysis of a previously published randomized controlled trial (RCT) in young men and women supplemented day DHA for 12 weeks (24, 40). In that study, DHA supplementation increased plasma EPA levels from 59 to , however, the values did not change despite the significantly higher -DHA of the supplement. If increased retroconversion had occurred, the in plasma would have shifted toward that of in the supplement; however, the lack of change in plasma indicated that the source of the higher EPA remained primarily ALA. In the current study, we stratified the data by sex and the ELOVL2 SNP rs953413 and found that the change in plasma EPA was potentially dependant on rs953413, with the AA genotype resulting in a significantly higher EPA increase compared to the combined GA + GG genotype. Although a sex effect trend ( ) was revealed that may be driving these findings, due to the secondary nature of our analysis we may be underpowered to detect this effect, and additional appropriately powered clinical trials are warranted. However, the role of this rs953413 SNP, in addition to rs3734398 and rs2236212 ELOVL2 SNPs, has been assessed in a mixed sex population following 6 months of , and fish oil supplementation (57). Following the dose only, there were significant genotype effects for EPA levels for each of the aforementioned SNPs, with the GA + AA genotype of rs953413 displaying significantly higher EPA compared to the GG genotype. However, with mixed EPA + DHA fish oil supplementation, firm conclusions on the source of the increased EPA are not possible. The rs953413 SNP is located within an evolutionarily conserved enhancer region, and acts as an important regulator for ELOVL2 expression, particularly via the cooperation of FOXA1/FOXA2 and HNF4 to increase expression in the G allele (58). If DHA supplementation was to decrease FOXA1, FOXA2, and/or HNF4 , this could result in downregulation of expression in the GG genotype, thereby resulting in a relatively larger increase in EPA for those with the AA genotype. However, to our knowledge, the effects of DHA supplementation on these protein levels have not been investigated and represents an intriguing avenue of research.
The inhibition of EPA metabolism with DHA supplementation has significant implications for our understanding of how tissues, like the brain, obtain DHA. Our results demonstrate that when DHA is consumed in the diet, it inhibits its own synthesis from ALA by decreasing the elongation of EPA which then accumulates. Thus, when liver cannot be assessed directly, such as in clinical studies, augmentation of EPA coupled with CSIA can be used as a surrogate to
measure the inhibition of EPA elongation. Conversely, when DHA is absent in the diet, as would be common in vegans and those who do not consume fish, EPA elongation is not inhibited, and ALA can be used to synthesize DHA. Future work examining the effects of development, genetics, and stress on the responsiveness of this pathway are warranted. Beyond this, a literature is emerging suggesting that DHA may alter the effects from EPA (59, 60). RCTs using mixed EPA/DHA supplements to reduce cardiovascular disease end points have been unsuccessful while two RCTs supplementing EPA alone reported cardiovascular benefits (63, 64). Similar meta-analysis findings have been identified for major depression (65). Our mechanistic findings could help explain the contradictory RCT findings. EPA, when supplemented alone, is free for downstream conversion to DPAn-3 and its bioactive metabolites. However, when combined with DHA, EPA metabolism is inhibited and less available for potentially antiinflammatory metabolite production.
In summary, we have shown clearly that EPA accumulation with increasing DHA levels results predominantly from impaired EPA elongation to DPAn-3 in a negative feedback system via the uncompetitive inhibition of the enzymes involved, likely liver ELOVL2. Furthermore, individuals with the AA genotype in the ELOVL2 SNP, rs953413, show larger increases in EPA with DHA supplementation. Although we did not reveal any sex effects, a trend was observed, and we may have been underpowered to detect these differences, and future studies should focus on investigating the sex-specific effects of dietary DHA inhibition of EPA elongation. In conclusion, the inhibition of liver DHA synthesis by dietary DHA reveals a mechanism by which dietary DHA controls the source and delivery of DHA to the brain.

Data availability

Additional data is to be shared upon request from the corresponding author (A. H. M.). Bri

Supplemental data

This article contains supplemental data.

Acknowledgments

GC-C-IRMS analysis was performed by the Environmental Isotope Laboratory, Department of Earth and Environmental Sciences at the University of Waterloo (UW-EIL) with the assistance of Rhys Gwynne. This work was supported by the Natural Sciences and Engineering Research Council of Canada (RGPIN-2017-06465), the Canadian Institutes of Health Research (PJT-173507) and the Ontario Ministry of Agriculture, Food and Rural Affairs (2093).

Author contributions

A. H. M., R. V., B. J. K., G. C., R. D. R., and M. G.-S. investigation; A. H. M., R. V., C. C.-G., D. M. M., and R. P. B. methodology; A. H. M., R. V., R. D. R., and M. G.-S. formal
analysis; A. H. M., S. L., C. M., D. M. M. and R. P. B. conceptualization; A. H. M., C. C.-G., and R. P. B. validation; A. H. M. visualization; A. H. M. writing-original draft; R. V., B. J. K., G. C., R. D. R., M. G.-S., C. C.-G., S. L., C. M., D. M. M., and R. P. B. writing-review and editing; S. L., C. M., D. M. M., and R. P. B. supervision; C. C.-G., C. M., D. M. M., and R. P. B. resources; D. M. M. and R. P. B. project administration; R. P. B. funding acquisition.

Author ORCIDs

Conflict of interest

D. M. M. has received research grants from the Canola Council of Canada and the Dairy Farmers of Canada. R. P. B. has received industrial grants, including those matched by the Canadian government, and/or travel support related to work on brain fatty acid uptake from Arctic Nutrition, Bunge Ltd, DSM, Fonterra, Mead Johnson, and Nestle, Inc. Moreover, R. P. B. is on the executive of the International Society for the Study of Fatty Acids and Lipids and held a meeting on behalf of Fatty Acids and Cell Signaling, both of which rely on corporate sponsorship. R. P. B. has given expert testimony in relation to supplements and the brain and holds the Canada Research Chair in Brain Lipid Metabolism. A. H. M. is a board member of the ISSFAL. None of the other authors report a conflict of interest related to research presented in this article.

Abbreviations

, carbon-13 abundance; ALA, -linolenic acid; C IRMS, combustion-isotope ratio mass spectrometry; CSIA, compound-specific isotope analysis; ELOVL, elongation of very long chain; DPAn-3, n-3 docosapentaenoic acid; FADS, fatty acid desaturase; FAMEs, fatty acid methyl esters; FID, flame ionization detection; RCT, randomized controlled trial.
Manuscript received March 6, 2024, and in revised form April 13, 2024. Published, JLR Papers in Press, April 20, 2024, https://doi.org/10.1016/jjlr.2024.100548

REFERENCES

  1. Bazinet, R. P., and Laye, S. (2014) Polyunsaturated fatty acids and their metabolites in brain function and disease. Nat. Rev. Neurosci. 15, 771-785
  2. Dyall, S. C., Balas, L., Bazan, N. G., Brenna, J. T., Chiang, N., da Costa Souza, F., et al. (2022) Polyunsaturated fatty acids and fatty acid-derived lipid mediators: recent advances in the understanding of their biosynthesis, structures, and functions. Prog. Lipid Res. 86, 101165
  3. Lee, J. W., Huang, B. X., Kwon, H., Rashid, M. A., Kharebava, G., Desai, A., et al. (2016) Orphan GPR110 (ADGRF1) targeted by Ndocosahexaenoylethanolamine in development of neurons and cognitive function. Nat. Commun. 7, 13123
  4. Liu, J., Sahin, C., Ahmad, S., Magomedova, L., Zhang, M., Jia, Z., et al. (2022) The omega-3 hydroxy fatty acid 7(S)-HDHA is a high-affinity PPARalpha ligand that regulates brain neuronal morphology. Sci. Signal. 15, eabol857
  5. Dalli, J., and Serhan, C. N. (2018) Immunoresolvents signaling molecules at intersection between the brain and immune system. Curr. Opin. Immunol. 50, 48-54
  6. Lukiw, W. J., Cui, J. G., Marcheselli, V. L., Bodker, M., Botkjaer, A., Gotlinger, K., et al. (2005) A role for docosahexaenoic acidderived neuroprotectin D1 in neural cell survival and Alzheimer disease. J. Clin. Invest. 115, 2774-2783
  7. Park, T., Chen, H., and Kim, H. Y. (2019) GPR110 (ADGRF1) mediates anti-inflammatory effects of N-docosahexaenoylethanolamine. J. Neuroinflammation. 16, 225
  8. Akbar, M., Calderon, F., Wen, Z., and Kim, H. Y. (2005) Docosahexaenoic acid: a positive modulator of Akt signaling in neuronal survival. Proc. Natl. Acad. Sci. U S A. 102, 10858-10863
  9. Asatryan, A., and Bazan, N. G. (2017) Molecular mechanisms of signaling via the docosanoid neuroprotectin D1 for cellular homeostasis and neuroprotection. J. Biol. Chem. 292, 12390-12397
  10. Chen, C. T., Domenichiello, A. F., Trepanier, M. O., Liu, Z., Masoodi, M., and Bazinet, R. P. (2013) The low levels of eicosapentaenoic acid in rat brain phospholipids are maintained via multiple redundant mechanisms. J. Lipid Res. 54, 2410-2422
  11. Igarashi, M., Ma, K., Chang, L., Bell, J. M., Rapoport, S. I., and DeMar, J. C., Jr. (2006) Low liver conversion rate of alphalinolenic to docosahexaenoic acid in awake rats on a high-docosahexaenoate-containing diet. J. Lipid Res. 47, 1812-1822
  12. Scott, B. L., and Bazan, N. G. (1989) Membrane docosahexaenoate is supplied to the developing brain and retina by the liver. Proc. Natl. Acad. Sci. U. S. A. 86, 2903-2907
  13. Valenzuela, R., Metherel, A. H., Cisbani, G., Smith, M. E., Choui-nard-Watkins, R., Klievik, B. J., et al. (2023) Protein concentrations and activities of fatty acid desaturase and elongase enzymes in liver, brain, testicle, and kidney from mice: substrate dependency. Biofactors. 50, 89-100
  14. Igarashi, M., DeMar, J. C., Jr., Ma, K., Chang, L., Bell, J. M., and Rapoport, S. I. (2007) Docosahexaenoic acid synthesis from alpha-linolenic acid by rat brain is unaffected by dietary n-3 PUFA deprivation. J. Lipid Res. 48, 1150-1158
  15. Igarashi, M., DeMar, J. C., Jr., Ma, K., Chang, L., Bell, J. M., and Rapoport, S. I. (2007) Upregulated liver conversion of alphalinolenic acid to docosahexaenoic acid in rats on a 15 week n-3 PUFA-deficient diet. J. Lipid Res. 48, 152-164
  16. von Schacky, C., and Weber, P. C. (1985) Metabolism and effects on platelet function of the purified eicosapentaenoic and docosahexaenoic acids in humans. J. Clin. Invest. 76, 2446-2450
  17. Conquer, J. A., and Holub, B. J. (1996) Supplementation with an algae source of docosahexaenoic acid increases (n-3) fatty acid status and alters selected risk factors for heart disease in vegetarian subjects. J. Nutr. 126, 3032-3039
  18. Rambjor, G. S., Walen, A. I., Windsor, S. L., and Harris, W. S. (1996) Eicosapentaenoic acid is primarily responsible for hypotriglyceridemic effect of fish oil in humans. Lipids. 31 Suppl, S45-S49
  19. Conquer, J. A., and Holub, B. J. (1997) Dietary docosahexaenoic acid as a source of eicosapentaenoic acid in vegetarians and omnivores. Lipids. 32, 341-345
  20. Stark, K. D., and Holub, B. J. (2004) Differential eicosapentaenoic acid elevations and altered cardiovascular disease risk factor responses after supplementation with docosahexaenoic acid in postmenopausal women receiving and not receiving hormone replacement therapy. Am. J. Clin. Nutr. 79, 765-773
  21. Schuchardt, J. P., Ostermann, A. I., Stork, L., Kutzner, L., Kohrs, H., Greupner, T., et al. (2016) Effects of docosahexaenoic acid supplementation on PUFA levels in red blood cells and plasma. Prostaglandins Leukot. Essent. Fatty Acids. 115, 12-23
  22. Allaire, J., Harris, W. S., Vors, C., Charest, A., Marin, J., Jackson, K. H., et al. (2017) Supplementation with high-dose docosahexaenoic acid increases the Omega-3 Index more than high-dose eicosapentaenoic acid. Prostaglandins Leukot. Essent. Fatty Acids. 120, 8-14
  23. Guo, X. F., Sinclair, A. J., Kaur, G., and Li, D. (2018) Differential effects of EPA, DPA and DHA on cardio-metabolic risk factors in high-fat diet fed mice. Prostaglandins Leukot. Essent. Fatty Acids. 136, 47-55
  24. Metherel, A. H., Irfan, M., Klingel, S. L., Mutch, D. M., and Bazinet, R. P. (2019) Compound-specific isotope analysis reveals no retroconversion of DHA to EPA but substantial conversion of EPA to DHA following supplementation: a randomized control trial. Am. J. Clin. Nutr. 110, 823-831
  25. Willumsen, N., Vaagenes, H., Lie, O., Rustan, A. C., and Berge, R. K. (1996) Eicosapentaenoic acid, but not docosahexaenoic acid, increases mitochondrial fatty acid oxidation and upregulates 2,
4-dienoyl-CoA reductase gene expression in rats. Lipids. 31, 579-592
26. Depner, C. M., Philbrick, K. A., and Jump, D. B. (2013) Docosahexaenoic acid attenuates hepatic inflammation, oxidative stress, and fibrosis without decreasing hepatosteatosis in a Ldlr(-/-) mouse model of western diet-induced nonalcoholic steatohepatitis. J. Nutr. 143, 315-323
27. Suzuki-Kemuriyama, N., Matsuzaka, T., Kuba, M., Ohno, H., Han, S. I., Takeuchi, Y., et al. (2016) Different effects of eicosapentaenoic and docosahexaenoic acids on atherogenic high-fat diet-induced non-alcoholic fatty liver disease in mice. PLoS One. 11, e0157580
28. Lytle, K. A., Wong, C. P., and Jump, D. B. (2017) Docosahexaenoic acid blocks progression of western diet-induced nonalcoholic steatohepatitis in obese Ldlr-/- mice. PLoS One. 12, e0173376
29. Metherel, A. H., Domenichiello, A. F., Kitson, A. P., Lin, Y. H., and Bazinet, R. P. (2017) Serum n-3 tetracosapentaenoic acid and tetracosahexaenoic acid increase following higher dietary alpha-linolenic acid but not docosahexaenoic acid. Lipids. 52, 167-172
30. Leng, S., Winter, T., and Aukema, H. M. (2018) Dietary ALA, EPA and DHA have distinct effects on oxylipin profiles in female and male rat kidney, liver and serum. J. Nutr. Biochem. 57, 228-237
31. Metherel, A. H., Lacombe, R. J. S., Aristizabal Henao, J. J., MorinRivron, D., Kitson, A. P., Hopperton, K. E., et al. (2018) Two weeks of docosahexaenoic acid (DHA) supplementation increases synthesis-secretion kinetics of n-3 polyunsaturated fatty acids compared to 8 weeks of DHA supplementation. J. Nutr. Biochem. 60, 24-34
32. Drouin, G., Catheline, D., Guillocheau, E., Gueret, P., Baudry, C., Le Ruyet, P., et al. (2019) Comparative effects of dietary n-3 docosapentaenoic acid (DPA), DHA and EPA on plasma lipid parameters, oxidative status and fatty acid tissue composition. . Nutr. Biochem. 63, 186-196
33. Schlenk, H., Sand, D. M., and Gellerman, J. L. (1969) Retroconversion of docosahexaenoic acid in the rat. Biochim. Biophys. Acta. 187, 201-207
34. Lacombe, R. J. S., and Bazinet, R. P. (2021) Natural abundance carbon isotope ratio analysis and its application in the study of diet and metabolism. Nutr. Rev. 79, 869-888
35. Meier-Augenstein, W. (1999) Applied gas chromatography coupled to isotope ratio mass spectrometry. J. Chromatogr. A. 842, 351-371
36. Metherel, A. H., Chouinard-Watkins, R., Trepanier, M. O., Lacombe, R. J. S., and Bazinet, R. P. (2017) Retroconversion is a minor contributor to increases in eicosapentaenoic acid following docosahexaenoic acid feeding as determined by compound specific isotope analysis in rat liver. Nutr. Metab. (Lond.). 14, 75
37. Lacombe, R. J. S., Lee, C. C., and Bazinet, R. P. (2020) Turnover of brain DHA in mice is accurately determined by tracer-free natural abundance carbon isotope ratio analysis. J. Lipid Res. 61, 116-126
38. Domenichiello, A. F., Kitson, A. P., Metherel, A. H., Chen, C. T., Hopperton, K. E., Stavro, P. M., et al. (2017) Whole-body docosahexaenoic acid synthesis-secretion rates in rats are constant across a large range of dietary alpha-linolenic acid intakes. . Nutr. 147, 37-44
39. Metherel, A. H., Lacombe, R. J. S., Chouinard-Watkins, R., and Bazinet, R. P. (2019) Docosahexaenoic acid is both a product of and a precursor to tetracosahexaenoic acid in the rat. J. Lipid Res. 60, 412-420
40. Klingel, S. L., Metherel, A. H., Irfan, M., Rajna, A., Chabowski, A., Bazinet, R. P., et al. (2019) EPA and DHA have divergent effects on serum triglycerides and lipogenesis, but similar effects on lipoprotein lipase activity: a randomized controlled trial. Am. J. Clin. Nutr. 110, 1502-1509
41. Folch, J., Lees, M., and Sloane Stanley, G. H. (1957) A simple method for the isolation and purification of total lipides from animal tissues. J. Biol. Chem. 226, 497-509
42. Metherel, A. H., Irfan, M., Klingel, S. L., Mutch, D. M., and Bazinet, R. P. (2021) Higher increase in plasma DHA in females compared to males following EPA supplementation may be influenced by a polymorphism in ELOVL2: an exploratory study. Lipids. 56, 211-228
43. Klingel, S. L., Roke, K., Hidalgo, B., Aslibekyan, S., Straka, R. J., An, P., et al. (2017) Sex differences in blood HDL-c, the total
cholesterol/HDL-c ratio, and palmitoleic acid are not associated with variants in common candidate genes. Lipids. 52, 969-980
44. Su, H. M., and Brenna, J. T. (1998) Simultaneous measurement of desaturase activities using stable isotope tracers or a nontracer method. Anal. Biochem. 261, 43-50
45. Valenzuela, R., Barrera, C., Gonzalez-Astorga, M., Sanhueza, J., and Valenzuela, A. (2014) Alpha linolenic acid (ALA) from Rosa canina, sacha inchi and chia oils may increase ALA accretion and its conversion into n-3 LCPUFA in diverse tissues of the rat. Food Funct. 5, 1564-1572
46. Giuliano, V., Lacombe, R. J. S., Hopperton, K. E., and Bazinet, R. P. (2018) Applying stable carbon isotopic analysis at the natural abundance level to determine the origin of docosahexaenoic acid in the brain of the fat-1 mouse. Biochim. Biophys. Acta Mol. Cell Biol. Lipids. 1863, 1388-1398
47. Lacombe, R. J. S., Giuliano, V., Colombo, S. M., Arts, M. T., and Bazinet, R. P. (2017) Compound-specific isotope analysis resolves the dietary origin of docosahexaenoic acid in the mouse brain. J. Lipid Res. 58, 2071-2081
48. Domenichiello, A. F., Chen, C. T., Trepanier, M. O., Stavro, P. M., and Bazinet, R. P. (2014) Whole body synthesis rates of DHA from alpha-linolenic acid are greater than brain DHA accretion and uptake rates in adult rats. J. Lipid Res. 55, 62-74
49. DeNiro, M. J., and Epstein, S. (1977) Mechanism of carbon isotope fractionation associated with lipid synthesis. Science. 197, 261-263
50. Gregory, M. K., Gibson, R. A., Cook-Johnson, R. J., Cleland, L. G., and James, M. J. (2011) Elongase reactions as control points in long-chain polyunsaturated fatty acid synthesis. PLoS One. 6, e29662
51. Wang, Y., Botolin, D., Christian, B., Busik, J., Xu, J., and Jump, D. B. (2005) Tissue-specific, nutritional, and developmental regulation of rat fatty acid elongases. J. Lipid Res. 46, 706-715
52. Pauter, A. M., Olsson, P., Asadi, A., Herslof, B., Csikasz, R. I., Zadravec, D., et al. (2014) Elov12 ablation demonstrates that systemic DHA is endogenously produced and is essential for lipid homeostasis in mice. J. Lipid Res. 55, 718-728
53. Metherel, A. H., and Bazinet, R. P. (2019) Updates to the n-3 polyunsaturated fatty acid biosynthesis pathway: DHA synthesis rates, tetracosahexaenoic acid and (minimal) retroconversion. Prog. Lipid Res. 76, 101008
54. Bazinet, R. P., Weis, M. T., Rapoport, S. I., and Rosenberger, T. A. (2006) Valproic acid selectively inhibits conversion of arachidonic acid to arachidonoyl-CoA by brain microsomal longchain fatty acyl-CoA synthetases: relevance to bipolar disorder. Psychopharmacology (Berl.). 184, 122-129
55. Gotoh, N., Nagao, K., Ishida, H., Nakamitsu, K., Yoshinaga, K., Nagai, T., et al. (2018) Metabolism of natural highly unsaturated fatty acid, tetracosahexaenoic acid (24:6n-3), in C57BL/KsJ-db/ db mice. J. Oleo Sci. 67, 1597-1607
56. Liu, L., Hu, Q., Wu, H., Wang, X., Gao, C., Chen, G., et al. (2018) Dietary DHA/EPA ratio changes fatty acid composition and attenuates diet-induced accumulation of lipid in the liver of ApoE(-/-) mice. Oxid. Med. Cell Longev. 2018, 6256802
57. Alsaleh, A., Maniou, Z., Lewis, F. J., Hall, W. L., Sanders, T. A., and O’Dell, S. D. (2014) ELOVL2 gene polymorphisms are associated with increases in plasma eicosapentaenoic and docosahexaenoic acid proportions after fish oil supplement. Genes Nutr. 9, 362
58. Pan, G., Cavalli, M., Carlsson, B., Skrtic, S., Kumar, C., and Wadelius, C. (2020) rs953413 regulates polyunsaturated fatty acid metabolism by modulating ELOVL2 expression. iScience. 23, 100808
59. Pal, A., Metherel, A. H., Fiabane, L., Buddenbaum, N., Bazinet, R. P., and Shaikh, S. R. (2020) Do eicosapentaenoic acid and docosahexaenoic acid have the potential to compete against each other? Nutrients. 12, 3718
60. Le, V. T., Knight, S., Watrous, J. D., Najhawan, M., Dao, K., McCubrey, R. O., et al. (2023) Higher docosahexaenoic acid levels lower the protective impact of eicosapentaenoic acid on longterm major cardiovascular events. Front. Cardiovasc. Med. 10, 1229130
61. ASCEND Study Collaborative Group, Bowman, L., Mafham, M., Wallendszus, K., Stevens, W., Buck, G., et al. (2018) Effects of n-3 fatty acid supplements in diabetes mellitus. N. Engl. J. Med. 379, 1540-1550
62. Manson, J. E., Cook, N. R., Lee, I. M., Christen, W., Bassuk, S. S., Mora, S., et al. (2019) Marine n-3 fatty acids and prevention of cardiovascular disease and cancer. N. Engl. J. Med. 380, 23-32
63. Bhatt, D. L., Steg, P. G., Miller, M., Brinton, E. A., Jacobson, T. A., Ketchum, S. B., et al. (2019) Cardiovascular risk reduction with icosapent ethyl for hypertriglyceridemia. N. Engl. J. Med. 380, 11-22
64. Yokoyama, M., Origasa, H., Matsuzaki, M., Matsuzawa, Y., Saito, Y., Ishikawa, Y., et al. (2007) Effects of eicosapentaenoic acid on major coronary events in hypercholesterolaemic patients
(JELIS): a randomised open-label, blinded endpoint analysis. Lancet. 369, 1090-1098
65. Firth, J., Teasdale, S. B., Allott, K., Siskind, D., Marx, W., Cotter, J., et al. (2019) The efficacy and safety of nutrient supplements in the treatment of mental disorders: a meta-review of metaanalyses of randomized controlled trials. World Psychiatry. 18, 308-324
  1. *For correspondence: Adam H. Metherel, adam.metherel@utoronto.ca.