دراسة عن وبائيات حمى المالطية في سكان الماشية في المناطق شبه الحضرية والريفية من منطقة ملتان، جنوب البنجاب، باكستان A study on the epidemiology of brucellosis in bovine population of peri-urban and rural areas of district Multan, southern Punjab, Pakistan

المجلة: BMC Veterinary Research، المجلد: 20، العدد: 1
DOI: https://doi.org/10.1186/s12917-024-03880-9
PMID: https://pubmed.ncbi.nlm.nih.gov/38297263
تاريخ النشر: 2024-01-31

دراسة عن وبائيات حمى المالطية في سكان الماشية في المناطق شبه الحضرية والريفية من منطقة ملتان، جنوب البنجاب، باكستان

ميان محمد أوايس , جوهر خادم , مسعود أختار , محمد إيرفان أنور , عبد السمد علي خان شيرواني , أحمد رضا , عبد الرزاق , زاهدة فاطمة , محمد أمجد علي و محمد سبتين بهاتي

الملخص

خلفية: داء البروسيلات هو مرض حيواني المنشأ تسببه بكتيريا تنتمي إلى جنس بروسيلة. إنه واحد من أكثر الأمراض البكتيرية الحيوانية المنشأ شيوعًا على مستوى العالم، ولكن للأسف، لا يزال يعتبر مرضًا مهملًا في العالم النامي. بناءً على ذلك، تم إجراء هذه الدراسة لتحديد انتشار وعوامل خطر داء البروسيلات في المجترات الكبيرة في المناطق شبه الحضرية والريفية من منطقة ملتان-باكستان. لهذا الغرض، تم جمع عينات دم ( ) من سكان الماشية ( ) و الجاموس ( ) في منطقة الدراسة وخضعت لفحص أولي لداء البروسيلات باستخدام كواشف RBPT المحلية والمستوردة. تم تحليل جميع العينات بشكل إضافي باستخدام مجموعة ELISA غير المباشرة متعددة الأنواع المتاحة تجاريًا، تلاها تأكيدها بواسطة PCR باستخدام بادئات محددة للجنس والأنواع. تم إخضاع البيانات المستمدة من التحليل المختبري والاستبيانات لتحليل إحصائي لجدول كاي لبييرسون، ونسبة الأرجحية وفواصل الثقة (95%). النتائج: أظهرت النتائج أن أعلى نسبة إيجابية كانت مسجلة باستخدام كاشف RBPT المحلي (VRI، باكستان؛ 12.45٪؛ 95%CI=9.72-15.65%) تليها RBPT-IDEXX ( ; 95%CI=9.52-15.45%) و RBPT-ID.vet ( ; ) ومع ذلك، كانت الفروق الإحصائية غير ذات دلالة ( ). أظهرت نتائج ELISA معدل انتشار إيجابي عام قدره مع معدل أعلى بشكل ملحوظ في الماشية ( ; ) مقارنة بالجاموس ( ). أكد تحليل PCR وجود جنس بروسيلة في جميع العينات الإيجابية، بينما كانت نسبة B. abortus و B. melitensis في العينات الإيجابية 80٪ و 20٪ على التوالي. كما لوحظ التعايش بين كلا النوعين في 5.45٪ من العينات. أظهر التحليل الإحصائي ارتباطًا كبيرًا بين داء البروسيلات في الماشية وحجم القطيع، والسلالة، والاضطرابات التناسلية،

طريقة التلقيح، الحالة التعليمية ووعي المزارعين حول داء البروسيلات ( ). على العكس، لم يكن للموقع، والعمر، والوزن، والجنس، وحالة الحمل، والولادة، وحالة البلوغ أي ارتباطات مع داء البروسيلات ( ).
الخاتمة: في الختام، داء البروسيلات منتشر في المجترات الكبيرة في منطقة ملتان، باكستان. يُقترح وضع وتنفيذ سياسات صارمة للسيطرة الفعالة والوقاية من داء البروسيلات في المنطقة. علاوة على ذلك، فإن الوضع الحالي يتطلب أيضًا تعزيز التنسيق بين التخصصات بين الأطباء البيطريين والأطباء في منظور الصحة الواحدة لضمان وتعزيز أنظمة الرعاية الصحية البشرية والحيوانية في المنطقة.
الكلمات الرئيسية: داء البروسيلات؛ الانتشار، عوامل الخطر، i-ELISA، الكشف الجزيئي، ملتان-باكستان

الخلفية

داء البروسيلات هو مرض بكتيري مهم يؤثر على الحيوانات المستأنسة بما في ذلك المجترات، والخنازير والكلاب مع آثار حيوانية المنشأ [1،2]. تسببه أنواع مختلفة من جنس بروسيلة (B.)، من بينها . abortus، B. melitensis، B. canis و B. suis هي الأنواع الأكثر أهمية من حيث قدرتها على التسبب في الأمراض الحيوانية المنشأ [3]. له توزيع جغرافي عالمي ولكنه أكثر انتشارًا في البلدان النامية [4]. يُصاب حوالي 0.5 مليون شخص بهذا المرض سنويًا [5]. في البشر، ينتقل بشكل رئيسي عن طريق الاتصال الوثيق مع الحيوانات المصابة، وإفرازاتها، واستهلاك اللحوم، والحليب ومنتجات الألبان الملوثة، بينما في الحيوانات، ينتقل عن طريق الاتصال المباشر أو غير المباشر بين الحيوانات السليمة والمصابة مما يسبب الإجهاض والعقم في مضيفيها الطبيعيين الأساسيين [6، 7]. كما تم إثبات أنه خطر صحي مهني لمربي الماشية والمهنيين في مجال الرعاية الصحية الحيوانية [8]. في المناطق الموبوءة في العالم، يسبب خسائر اقتصادية كبيرة في قطاع الثروة الحيوانية من حيث ضعف الأداء الإنتاجي، والعقم، والإجهاض في الحيوانات المصابة. بالإضافة إلى ذلك، فإنه يؤثر سلبًا على التنمية الاجتماعية والاقتصادية للدول المتأثرة من خلال التأثير على أنظمة الرعاية الصحية البشرية، والقيود على تجارة الحيوانات/ منتجاتها وصناعة السياحة [1]. تعتبر البلدان ذات الدخل المنخفض والمتوسط في آسيا (بما في ذلك باكستان)، والشرق الأوسط، وحافة البحر الأبيض المتوسط (إسبانيا، اليونان، والبرتغال)، وأمريكا الوسطى والجنوبية وأفريقيا مبللة بداء البروسيلات، ولكن بعض الدول المتقدمة في العالم قد نجحت أيضًا في منع أو القضاء على هذا المرض الحيواني المنشأ من خلال اتخاذ تدابير صارمة [9، 10].
في صناعة الثروة الحيوانية، تساهم عوامل الإدارة والبيئة والحيوانات في حدوث هذا المرض. قد تشمل عوامل الإدارة التطعيم، والتعامل مع الحيوانات، ونظافة المزرعة، وفحص الحيوانات المشتراة حديثًا، وممارسات التربية، واستراتيجيات الحلب، وحجم القطيع وأنظمة الإنتاج [8،11]. من ناحية أخرى، تشمل عوامل الحيوانات الجنس، والسلالة، والعمر وتاريخ الإجهاض، بينما تتكون العوامل البيئية بشكل رئيسي من الموقع الزراعي البيئي للحيوانات [12، 13]. كما كشفت الأدبيات أن حدوث هذا
المرض مرتفع في المناطق الرعوية مقارنة بالمناطق الحضرية [14]. علاوة على ذلك، فإن القدرة على البقاء لبروسيلة في البيئات الباردة والرطبة هي عامل مهم آخر لنقل هذا المرض في الثروة الحيوانية والبشر [15]. تعزز العوامل السلوكية البشرية مثل الظروف غير الصحية وغيرها من الأنشطة التي تعرض الناس للحيوانات المصابة ومنتجاتها فرص الإصابة بالمرض لدى البشر [16]. بشكل عام، يمكن اعتبار المزارعين، وعمال المسالخ، وعمال المختبرات، والأشخاص الذين يشاركون في صناعة الثروة الحيوانية من الفئات عالية المخاطر [17]. العوامل الأخرى التي تعتبر حواجز رئيسية في السيطرة على داء البروسيلات هي السياسات التقليدية للثروة الحيوانية، والتأثيرات السياسية، وعدم كفاية تنفيذ تدابير السيطرة، واستخدام الممارسات التقليدية القديمة، واستهلاك منتجات الألبان غير المبسترة، والتغيرات في نظام تربية الحيوانات، وعدم كفاية التدابير للإبلاغ، والتشخيص والمراقبة لهذا المرض [10]. العلاج المناسب والوقاية من هذا المرض أمر لا بد منه لتجنب الخسائر الاقتصادية في قطاع الثروة الحيوانية. البلدان النامية متأخرة في تنفيذ استراتيجيات القضاء على داء البروسيلات [18-20]. على الرغم من أن منظمة الصحة العالمية (WHO) ومنظمة الصحة الحيوانية العالمية (WOAH) قد وضعت توصيات للقضاء على داء البروسيلات، إلا أنه لا يزال يعتبر تهديدًا صحيًا خطيرًا في البلدان النامية/ المتخلفة لأن تدابير السيطرة على القضاء على داء البروسيلات مكلفة، ومتعبة، وتستغرق وقتًا طويلاً. ومع ذلك، في البلدان الموبوءة، يمكن تجنب حدوثه من خلال التطعيم واستراتيجيات الذبح/ الإعدام [21].
نظرًا لوجود مرافق تشخيصية محدودة، لا يزال داء البروسيلات يعتبر مرضًا مهملًا في معظم أنحاء العالم بما في ذلك باكستان [22،23]. لهذا السبب، لم يتم استكشاف ديناميات وأهمية المرض الحيواني المنشأ بالكامل لوضع أي استراتيجية صارمة للتغلب على هذه القضية الصحية المهمة. في ظل الظروف السائدة، يعتمد الأطباء البيطريون الميدانيون على اختبار لوحة روز بنغال (RBPT) واختبار حلقة الحليب (MRT) للتشخيص السريع لداء البروسيلات في المجترات الكبيرة [24]. على أي حال، يُوصى دائمًا باستخدام RBPT مع اختبارات مصلية أخرى (ذات حساسية وخصوصية عالية) للحصول على تشخيص دقيق لتجنب النتائج الإيجابية الكاذبة وكذلك السلبية الكاذبة.
الجدول 1: فحص ومقارنة داء البروسيلات باستخدام مستضدات RBPT المتاحة تجاريًا المختلفة
% الإيجابية مع RBPT (n/T) (95%CI) -القيمة
VRI IDEXX ID.vet
الإجمالي 12.45 (61/490) (9.72-15.65) 12.24 (60/490) (9.52-15.45) 11.84 (58/490) (9.18-14.95) 0.089 0.956
الماشية 15.10 (37/245) (10.86-20.10) 15.92 (39/245) (11.70-21.03) 15.51 (38/245) (11.28-20.51) 0.062 0.969
الجاموس 9.79 (24/245) (6.49-14.15) 8.57 (21/245) (5.56-12.72) 8.16 (20/245) (5.14-12.31) 0.٤٣٩ 0.803
RBPT=اختبار صفيحة الورد البنفسجي؛ فترة الثقة؛ VRI معهد البحوث البيطرية؛ مربع كاي
الجدول 2: الانتشار العام ووفق الأنواع لحمى المالطية باستخدام مجموعة i-ELISA متعددة الأنواع
مجتر كبير إجمالي العينات (ن) العينات الإيجابية (ن) % انتشار الأجسام المضادة (95% فترة الثقة) -قيمة أو OR (فاصل الثقة 95%)
الحد الأدنى الحد الأقصى
بشكل عام ٤٩٠ ٥٥ 11.22 (8.59-14.33) – – –
المواشي 245 31 12.65 (8.82-17.44) 0.316 1.004 1.33 0.76 2.37
جاموس 245 ٢٤ 9.80 (6.49-14.15)
iELISA – اختبار الامتصاص المناعي المرتبط بالإنزيم غير المباشر؛ فترة الثقة؛ مربع كاي؛ OR=نسبة الأرجحية
نتائج سلبية [25]. لذلك، من أجل السيطرة الفعالة والوقاية، من الضروري إجراء دراسات حول الحمى المالطية باستخدام أدوات تشخيصية مصلية وجزيئية متطورة لتوليد بيانات أساسية حول انتشارها وعوامل الخطر المرتبطة بها. في باكستان، أفادت بعض الدراسات السابقة بانتشار الحمى المالطية وعوامل الخطر في بعض المناطق المختارة من البلاد [2628]، لكن المعلومات المتعلقة وبائيات الحمى المالطية نادرة/محدودة في جنوب البنجاب، الذي يعد مركز الثروة الحيوانية ويعيش فيه حوالي أكثر من من إجمالي عدد الثروة الحيوانية في محافظة البنجاب. بناءً على ذلك، تم إجراء هذه الدراسة لتقييم انتشار وعوامل الخطر المرتبطة بالبروسيلا في المجترات الكبيرة في منطقة ملتان، البنجاب – باكستان باستخدام تقنيات التشخيص المصلية والجزيئية. من المتوقع أن تكون البيانات الناتجة عن هذه الدراسة مفيدة لهيئات صنع السياسات/القرارات المتعلقة بالثروة الحيوانية لوضع استراتيجيات فعالة للسيطرة على البروسيلا في المجترات الكبيرة.

النتائج

فحص ومقارنة داء البروسيلات باستخدام مستضدات RBPT المتاحة تجارياً

في إجمالي عدد المجترات، تم تسجيل أعلى نسبة إيجابية للأجسام المضادة باستخدام اختبار RBPT-VRI. ; ) تليها RBPT-IDEXX ( ) و RBPT-ID.vet ( ; ). أظهرت التحليلات الإحصائية أن الفرق لم يكن ذا دلالة إحصائية ( ) مما أشار إلى أن جميع المستضدات جيدة بنفس القدر للفحص الأولي. لوحظ اتجاه مشابه في التحليل حسب الأنواع (الجدول 1).

انتشار داء البروسيلات بشكل عام وبحسب الأنواع

أظهرت نتائج التحليل باستخدام مجموعة ELISA غير المباشرة متعددة الأنواع أن انتشار داء البروسيلات بشكل عام في المجترات الكبيرة كان ( ; في التحليل حسب الأنواع، تم الكشف عن أن انتشار الأجسام المضادة لحمى المالطية كان أعلى بشكل ملحوظ في الماشية. ) مقارنةً بالجاموس ( ) كانت الفروق غير ذات دلالة إحصائية ( ) (الجدول 2).

الكشف الجزيئي عن أنواع البروسيلة في العينات الإيجابية لاختبار ELISA

تم إخضاع العينات الإيجابية لاختبار ELISA لعملية PCR لتأكيد وجود داء البروسيلات وكشف أنواع البروسيلة في العينات الإيجابية. أكدت النتائج وجود البروسيلة في جميع العينات الإيجابية لاختبار ELISA باستخدام بادئات محددة للجنس. من ناحية أخرى، كشفت نتائج PCR باستخدام بادئات محددة للأنواع أنه من إجمالي العينات الإيجابية، تم الكشف عن B. abortus في ( ) المجترات الكبيرة مع انتشار عام لـ تم اكتشاف ب. ميليتينسيس في ( ) من العينات الإيجابية مع انتشار عام لـ ( ) في المجترات الكبيرة. كانت التزامن المشترك لـ B. abortus و B. melitensis في العينات الإيجابية مع انتشار عام قدره ( ) في المجترات الكبيرة. تم تسجيل اتجاه مشابه في أعداد الماشية والجاموس عند تحليلها بشكل منفصل (الجدول 3).

انتشار مستوى المزرعة/القطيع حسب مستوى التهسيل

في هذه الدراسة، تم دراسة ما مجموعه 67 مزرعة تقع في المناطق شبه الحضرية والريفية في مختلف التهسيلي في منطقة ملتان.
الجدول 3 الكشف الجزيئي عن أنواع البروسيلة في العينات الإيجابية لاختبار ELISA بواسطة تفاعل البوليميراز المتسلسل
السكان بروسيلا spp. % (ن) ب. أبورتوس (BA) % (ن) ب. ميلتينسيس (BM) % (ن) كلا من BA و BM % (ن)
من عينات إيجابية لـ ELISA
بشكل عام 100 (55/55) 80 (44/55) 20 (11/55) 5.45 (3/55)
المواشي 100 (31/31) 80.64 (25/31) 19.36 (06/31) 3.22 (31/01)
جاموس 100 (24/24) 79.17 (19/24) 20.83 (5/24) 8.33 (02/24)
من إجمالي السكان
بشكل عام 11.22 (55/490) 8.98 (44/490) 2.24 (11/490) 0.61 (03/490)
المواشي 12.65 (31/245) 10.2 (25/245) 2.45 (06/245) 0.41 (01/245)
بافالو 9.80 (24/245) 7.76 (19/245) 2.04 (05/245) 0.82 (02/245)
تم أخذ عينات. عند حساب انتشار المرض على مستوى المزرعة/القطيع، تم اعتبار المزرعة/القطيع الذي يحتوي على حيوان إيجابي واحد على الأقل للأجسام المضادة للبروسيلا إيجابيًا. من إجمالي الحيوانات، كانت هناك حيوانات في 22 مزرعة إيجابية لمرض البروسيلا، مما يشير إلى انتشار المرض على مستوى المزرعة. ( في تحليل البيانات حسب التيسيل، تم الكشف عن أن انتشار المستوى الزراعي كان الأعلى في تيسيل ملتان. “; 95%CI=20.11-69.96%) تليها تلك الخاصة بشوجabad ( ) وجلالبور بيروالا (27.27؛ ومع ذلك، كانت الفروق غير ذات دلالة في تحليل انتشار داء البروسيلات حسب التقسيم الإداري، كانت أعلى نسبة انتشار ( تم تسجيله في المجترات الكبيرة في تحصيل ملتان تليها تلك في شجاع آباد ) وجلالبور بيروالا ( ومع ذلك، كانت الفروق غير ذات دلالة تم تسجيل اتجاه مشابه في أعداد الماشية والجاموس في مختلف التهسيلات، عند تحليلها بشكل منفصل (الجدول 4).

ارتباط المعايير الديموغرافية بانتشار حمى المالطية

أظهرت النتائج أعلى انتشار للحمى المالطية في المجترات الكبيرة التي تتراوح أعمارها سنوات ( ; OR=1.81; 95%CI OR ) يتبعها أولئك من سنوات ( ; أو ) و لكن سنوات ( ; بينما كانت الفروق الإحصائية بين الفئات العمرية المختلفة غير ذات دلالة تم تسجيل ارتباط غير ذي دلالة مشابه عند تحليل البيانات حسب العمر للأبقار. ) و الجاموس ( ) السكان، بشكل منفصل. أظهر التحليل حسب الجنس انتشارًا أعلى للحمى المالطية بين الإناث ( ) من المجترات الكبيرة مقارنة بالذكور (10.00%) ومع ذلك كانت الفروق غير ذات دلالة إحصائية ( ; أو ; سي أو 4.91). وبالمثل، تم تسجيل ارتباط غير ذي دلالة إحصائية بين الجنس وانتشار داء البروسيلات في الماشية. ; أو ; سي آي أو ) و الجاموس ( ; أو ) السكان عندما تم تحليل بياناتهم بشكل منفصل. في تحليل سلالات الماشية، تم تسجيل أعلى انتشار في الأنواع غير الموصوفة ( ; OR=2.08;
أو ) وسجلت أدنى نسبة انتشار في سلالة ساهيوال (6.49%; OR=0.56; 95%CI وكان الفرق في الانتشار بين السلالات المختلفة ذا دلالة إحصائية ). في عدد الجاموس، أظهرت الجاموس غير المميزة معدل انتشار أعلى ( ) مقارنة بسلالة نيلي-رافي (7.48%) وكانت الفروق ذات دلالة إحصائية ( ; أو سي أو ). أظهرت النتائج أيضًا ارتباطًا غير ذي دلالة ( ) بين وزن الجسم وانتشار داء البروسيلات في المجترات الكبيرة. اعتمادًا على عدد الولادات، تم تقسيم البيانات إلى مجموعتين من الإناث، وهما: i). مع عدد الولادات و ii). وجود أكثر من 3 ولادات. أظهرت التحليلات عدم وجود ارتباط ذو دلالة إحصائية بين عدد الولادات وانتشار داء البروسيلات في كل من قطعان الأبقار والجاموس. أو أو ). أظهر تحليل الارتباط لمرض البروسيلا مع الحالة الفسيولوجية للإناث ارتفاعًا طفيفًا في انتشار البروسيلا بين الإناث الحوامل ( ) مقارنة بالإناث غير الحوامل ( بينما كانت الفروق غير ذات دلالة إحصائية ; أو ; سي آي . وقد وُجد أن حجم القطيع مرتبط بشكل كبير بانتشار داء البروسيلات في المجترات الكبيرة ( ). بشكل عام، كانت نسبة الانتشار الأعلى في الحيوانات ذات حجم القطيع رؤوس ( ) وأدنى في الحيوانات التي تتراوح حجم قطيعها بين 11-100 رأس ( ; أو ). فيما يتعلق بحالة البلوغ لدى الإناث، تم تسجيل ارتباط غير ذي دلالة إحصائية بين حالة البلوغ وانتشار داء البروسيلات ( ; أو ; سي آي أو بناءً على بروتوكول التلقيح، التزاوج الطبيعي (OR=3.45؛ أو كان مرتبطًا بشكل كبير بارتفاع انتشار البروسيلا في المجترات الكبيرة بشكل عام ). لوحظ نفس الاتجاه في عدد الماشية ( ومع ذلك، في حالة الجاموس، كانت الفروق غير ذات دلالة. ). أظهرت النتائج أيضًا أن انتشار داء البروسيلات كان أعلى في الماشية التي تربى في مزارع تتواجد فيها المجترات الصغيرة مقارنة بتلك التي تربى في نظام تربية المجترات الكبيرة فقط؛ ومع ذلك، كانت الفروق غير ذات دلالة إحصائية ( ; أو ; سي أو (الجدول 5).
الجدول 4 انتشار داء البروسيلات على مستوى المزرعة/القطيع وحسب التهسيل في المجترات الكبيرة
الجرابيات الكبيرة % انتشار ( ) (95% فترة الثقة) -قيمة أو OR (فاصل الثقة 95%)
الحد الأدنى الحد الأقصى
مستوى القطيع
بشكل عام 32.83 (22/67) (22.00-44.82)
ملتان 43.75 (7/16) (20.11-69.96) 0.545 1.216 2.03 0.43 10.04
شوجabad 31.03 (9/29) (16.38-50.00) 1.2 0.3 5.02
جلالبور بيروالا 27.27 (6/22) (12.60-50.00) 1
الماشية الكبيرة حسب التهسيل
ملتان 12.07 (21/174) (7.85-17.66) 0.887 0.239 1.19 0.56 ٢.٥٩
شوجabad 11.11 (19/171) (7.04-16.78) 1.08 0.5 2.39
جلالبور بيروالا 10.34 (15/145) (5.91-16.35) 1
المواشي
ملتان 15.05 (14/93) (8.77-23.94) 0.673 0.791 1.36 0.45 ٤.٦١
شوجabad 11.00 (11/100) (5.87-18.72) 0.95 0.3 ٣.٣٣
جلالبور بيروالا 11.54 (6/52) (5.14-22.66) 1
بافالو
ملتان 8.64 (7/81) (3.91-16.91) 0.862 0.298 0.88 0.27 2.82
شوجabad 11.27 (8/71) (5.01-20.76) 1.18 0.37 3.68
جلالبور بيروالا 9.68 (9/93) (4.95-17.43) 1
فترة الثقة؛ مربع كاي؛ نسبة الأرجحية

ارتباط الاضطرابات التناسلية بانتشار حمى المالطية

أظهرت النتائج أن المجترات الكبيرة التي لديها تاريخ من الإجهاض أظهرت معدل انتشار أعلى ( ) مقارنةً بأولئك الذين ليس لديهم تاريخ إجهاض ( ) وكان الفرق كبيرًا ( ; OR=8.38; 95%CI ” ). تم ملاحظة ارتباط مشابه في مواشي الأبقار والجاموس عندما تم تحليل البيانات بشكل منفصل. وبالمثل، بعض الاضطرابات التناسلية الأخرى مثل تاريخ التزاوج المتكرر ( ; 95%CI OR=1.587.03) واحتباس الأغشية الجنينية (OR=6.44; 95%CI OR=2.98-13.60) أظهرت أيضًا ارتباطًا كبيرًا ( ) مع انتشار داء البروسيلات في المجترات الكبيرة في منطقة الدراسة (الجدول 6).

ارتباط الحالة التعليمية ومستوى الوعي لدى المزارعين بانتشار داء البروسيلات

الماشية الكبيرة التي يحتفظ بها المزارعون ذوو المستوى التعليمي المنخفض أظهرت نسبة انتشار أعلى (14.28%) مقارنةً بأولئك الذين لديهم مستوى تعليمي أعلى من الماتريكولاسيون. ) والفرق كان
ذو دلالة إحصائية ). وبالمثل، كان نقص الوعي حول البروسيلا له ارتباط كبير مع انتشار البروسيلا في المجترات الكبيرة ( ; OR=0.35; أو (الجدول 7).

نقاش

حمى البروسيلات هي مرض معدٍ له آثار زونوتية خطيرة تؤثر على كل من الحيوانات والبشر في جميع أنحاء العالم [8]. يؤثر بشكل كبير على قطاع الثروة الحيوانية ويؤدي إلى خسائر اقتصادية هائلة [29]. بالإضافة إلى الآثار السلبية في صناعة الثروة الحيوانية، يتم تسليط الضوء أيضًا على حمى البروسيلات كخطر مهني محتمل للأفراد المرتبطين بقطاع الثروة الحيوانية بما في ذلك المزارعين، وعمال الحلب، والرعاة، والمهنيين في الرعاية الصحية البيطرية، وعمال المسالخ، وما إلى ذلك [30]. في باكستان، تعتبر قضية صحية متزايدة الأهمية تتعلق بالصحة البيطرية والصحة العامة لأن معظم السكان الريفيين يعتمدون على قطاع الثروة الحيوانية لكسب رزقهم ويقضون معظم وقتهم في اتصال وثيق مع الحيوانات لتربيتها. في هذه الدراسة، تم رصد إيجابية الأجسام المضادة لـ
الجدول 5 ارتباط المعايير الديموغرافية بانتشار داء البروسيلات
الخصائص السكانية % انتشار ( (95% CI) قيمة P أو OR (فاصل الثقة 95%)
الحد الأدنى الحد الأقصى
العمر (بالسنوات)
بشكل عام
13.67 (19/139) (8.76-20.32) ٢.٧٧٧ 0.249 1.52 0.77 0.62
سنوات لكن 9.45 (29/307) (6.56-13.24) 1
أكثر من 8 15.91 (7/44) (7.21-29.18) 1.81 0.62 ٤.٦٢
المواشي
14.44 (13/90) (8.15-2308) 0.481 0.786 1.26 0.53 2.93
سنوات لكن 11.80 (17/144) (7.19-18.20) 1
أكثر من 8 9.09 (1/11) (0.46-40.11) 0.75 0.02 ٥.٨٩
جاموس
12.24 (6/49) (5.47-24.06) ٤.٠٥٢ 0.132 1.75 0.51 ٥.٤
سنوات لكن 7.36 (12/163) (4.07-12.38) 1
أكثر من 8 18.18 (6/33) (8.22-34.47) 2.78 0.79 2.78
جنس
بشكل عام
أنثى 11.30 (52/460) (8.61-14.50) 0.048 0.826 1.10 0.37 ٤.٩١
ذكر 10.00 (3/30) (2.77-25.96)
المواشي
أنثى 12.39 (29/234) (8.61-17.19) 0.319 0.572 0.61 0.14 ٤.٥٢
ذكر 18.18 (2/11) (3.32-50.01)
جاموس
أنثى 10.17 (23/226) (6.69-14.70) 0.479 0.489 1.80 0.34 ٤٤.٧٥
ذكر 5.26 (1/19) (0.26-25.17)
سلالة
المواشي
ساهيوال 6.49 (5/77) (2.59-14.50) 8.382 0.039 0.56 0.11 3.01
فريزيان 8.88 (4/45) (3.08-20.57) 0.78 0.13 ٤.٥٥
هجين 11.11 (4/36) (3.88-25.77) 1
غير مميز 20.69 (18/87) (12.82-30.27) 2.08 0.61 9.12
جاموس
نيلي رافي 7.48 (16/214) (4.50-11.76) 10.296 0.001 0.23 0.09 0.64
غير مميز 25.81 (31/8) (12.61-43.38)
حجم القطيع (عدد الرؤوس) الإجمالي
الجدول 5 (مستمر)
الخصائص السكانية % انتشار ( (95% CI) قيمة P أو OR (فاصل الثقة 95%)
الحد الأدنى الحد الأقصى
حتى 10 ٢٦.٢٢ (١٦/٦١) (١٥.٨٦-٣٨.٣٧) ٤٩.١٢٨ 0.000 0.9 0.39 2.05
من 11 إلى 100 5.07 (18/355) (3.13-7.78) 0.14 0.06 0.29
> 100 28.38 (21/74) (18.51-39.75) 1
المواشي
حتى 10 30.00 (9/30) (15.81-48.29) ٣٢.٢٥٩ 0.000 0.79 0.24 2.54
من 11 إلى 100 5.52 (10/181) (2.83-9.76) 0.11 0.04 0.31
> 100 ٣٥.٢٩ (١٢/٣٤) (١٩.٩٩-٥٣.٠٢) 1
بوفالو
حتى 10 22.58 (7/31) (10.26-40.06) 18.361 0.000 1 0.27 ٣.٥٤
من 11 إلى 100 4.60 (8/174) (2.04-8.71) 0.17 0.05 0.53
> 100 22.50 (9/40) (11.84-37.97) 1
التوازن العام
11.75 (39/332) (8.63-15.58) 0.233 0.629 1.17 0.61 2.36
>3 10.16 (13/128) (5.52-16.57)
المواشي
13.89 (25/180) (9.22-19.59) 1.607 0.205 1.95 0.71 7.05
>3 7.41 (4/54) (2.56-17.22)
جاموس
9.21 (14/152) (5.36-14.92) 0.474 0.491 0.73 0.30 1.85
>3 12.16 (9/74) (6.26-21.31)
الحمل
بشكل عام
نعم 12.24 (6/49) (5.47-24.06) 0.048 0.826 1.13 0.41 2.63
لا 11.19 (46/411) (8.41-14.64)
المواشي
نعم 15.00 (3/20) (4.21-36.94) 0.137 0.711 1.32 0.28 ٤.٣٤
لا 12.15 (26/214) (8.24-17.16)
جاموس
نعم 10.34 (3/29) (2.87-26.87) 0.001 0.974 1.06 0.23 3.42
لا 10.15 (20/197) (6.40-15.08)
حالة البلوغ العامة
الجدول 5 (مستمر)
الخصائص السكانية % انتشار ( (95% فترة الثقة) قيمة P أو OR (فاصل الثقة 95%)
الحد الأدنى الحد الأقصى
العجلات 16.67 (11/66) (9.14-27.73) ٢.٢١٠ 0.137 1.73 0.80 3.49
البالغون 10.41 (41/394) (7.64-13.76)
المواشي
العجلات 16.67 (5/30) (6.80-34.52) 0.579 0.447 1.53 0.47 ٤.١٤
البالغون 11.76 (24/204) (7.89-16.83)
جاموس
العجلات 16.67 (6/36) (7.51-32.03) 1.973 0.160 2.06 0.68 ٥.٥٠
البالغون 8.95 (17/190) (5.30-13.79)
طريقة التلقيح بشكل عام
التلقيح الصناعي 4.55 (5/110) (1.80-10.14) 7.436 0.024 1
التكاثر الطبيعي 14.14 (41/290) (10.39-10.57) ٣.٤٥ 1.31 11.50
غير مخصب 10.00 (6/60) (4.44-20.38) 2.32 0.56 10.08
المواشي
التلقيح الصناعي 4.44 (4/90) (1.52-10.74) 8.814 0.012 1
التكاثر الطبيعي 18.10 (21/116) (11.78-26.1) ٤.٧٢ 1.51 19.67
غير مخصب 14.29 (4/28) (5.02-31.61) 3.53 0.61 ٢٠.٥٠
جاموس
التلقيح الصناعي 5.00 (1/20) (0.25-23.88) 1.456 0.483 1
التكاثر الطبيعي 11.49 (20/174) (7.24-17.07) ٢.٤٦ 0.35 ١٠٧.٥٤
غير مخصب 6.25 (2/32) (1.12-19.59) 1.26 0.06 78.57
تربية الماعز الصغيرة بشكل مشترك
لا 9.19 (26/283) (6.23-13.13) 2.79 0.095 0.62 0.35 1.09
نعم 14.01 (29/207) (9.73-19.44)
تم تحديد داء البروسيلات باستخدام مواد مختلفة لاختبار RBPT وتم تسجيل فرق غير ذي دلالة في معدلات الإيجابية المصلية مع مستضدات مختلفة. ومع ذلك، كان اختبار RBPT-VRI المنتج محليًا هو الأرخص ويمكن استخدامه بفعالية كاختبار سريع واقتصادي تحت الظروف المحلية. كشفت نتائج ELISA أن انتشار داء البروسيلات في الأبقار في السكان المستهدفين كان . ومع ذلك، كشفت الخصائص الجزيئية عن انتشار أعلى لبكتيريا بروسيلة abortus في الحيوانات الإيجابية للفيروس. على عكس نتائجنا، أظهرت الدراسات التي أجريت في أجزاء مختلفة من العالم معدلات انتشار أعلى لحمى البروسيلات البقرية مثل في منطقة جيمّا،
إثيوبيا [31]، في جنوب غرب نيجيريا [32]، 28.9% في رواندا [33]، في 6 مناطق جنوبية من ألبانيا [34]، في الهند [35]، 31% في منطقة بحر الغزال في جنوب السودان [36]، و في غوا، الهند [37]. ومع ذلك، تم الإبلاغ عن معدلات انتشار أقل في بعض الدول الأخرى مثل في منطقة ألاج في إثيوبيا [38]، 3.40% في نغاونديري، الكاميرون [39]، 9.7% في حديقة نيشيسار الوطنية، إثيوبيا [40]، 0.4% في سندافا، منطقة أوروميا الخاصة، إثيوبيا [41]، 6.35% في جنوب الكاميرون [42]، و في إندونيسيا [43]. تشمل عدة عوامل مثل الظروف الجغرافية، وطرق أخذ العينات، وسلالة الحيوانات، وحجم القطيع، وطرق مختلفة
الجدول 6 ارتباط الاضطرابات التناسلية بانتشار حمى المالطية
اضطرابات الإنجاب %انتشار ( ) أو أو 95% فترة الثقة قيمة P
فترة الثقة 95% الحد الأدنى الحد الأقصى
تاريخ الإجهاض
بشكل عام
نعم 46.15 (12/26) (28.20-65.92) ٣٣.٣٨٠ 8.38 ٣.٥٥ 19.56 0.000
لا 9.22 (40/434) (6.71-12.26)
المواشي
نعم ٤٧.٠٦ (٨/١٧) (٢٥.٢٩-٧١.٧٩) ٢٠٫٢٩٠ 8.17 ٢.٧٥ ٢٤.٠٤ 0.000
لا 9.68 (21/217) (6.29-14.37)
جاموس
نعم 40.00 (4/10) (15.00-71.71) 10.180 6.87 1.57 27.08 0.001
لا 8.80 (19/216) (5.51-13.28)
تاريخ التكاثر المتكرر بشكل عام
نعم ٢٦.٦٧ (١٢/٤٥) (١٤.٨٤-٤١.١٠) 11.741 3.42 1.58 7.03 0.001
لا 9.64 (40/415) (7.01-12.81)
المواشي
نعم 28.00 (7/25) (12.76-47.94) 6.279 ٣.٣١ 1.16 8.66 0.012
لا 10.53 (22/209) (6.74-15.40)
جاموس
نعم 25.00 (5/20) (10.41-47.40) 5.274 3.51 1.02 10.44 0.022
لا 8.74 (18/206) (5.40-13.43)
تاريخ احتباس الأغشية الجنينية بشكل عام
نعم ٣٨.٨٨ (١٤/٣٦) (٢٤.١٦-٥٥.٧٠) ٢٩٫٦٤٠ 6.44 2.98 ١٣.٦٠ 0.000
لا 8.96 (38/424) (6.51-12.06)
المواشي
نعم 42.85 (6/14) (20.00-68.84) 12.728 6.37 1.90 ٢٠.٣٥ 0.000
لا 10.45 (23/220) (6.87-15.09)
جاموس
نعم ٣٦.٣٦ (٨/٢٢) (١٨.٧٠-٥٨.٢٤) 18.283 7.12 ٢.٤٧ 19.80 0.000
لا 7.35 (15/204) (4.19-11.84)
قد تكون أسباب التشخيص المحتملة هي الأسباب وراء تفاوت معدلات الانتشار في مناطق مختلفة من العالم. كانت نسبة انتشار داء البروسيلات البقري على مستوى القطيع في منطقة ملتان هي مع أعلى معدل انتشار في قطعان تحصيل ملتان تليها شجاع آباد وجلالبور بيروالا. كانت القطعان التي تحتوي على حيوان إيجابي واحد على الأقل لـ
تم اعتبار الأجسام المضادة للبروسيلا إيجابية [44]. لم يتم الإبلاغ سابقًا عن انتشار على مستوى القطيع في منطقة الدراسة. ومع ذلك، أفاد علي وآخرون [45]، وخان وآخرون [46] بـ و معدلات انتشار قائمة على القطيع لحمى البروسيلا البقرية في هضبة بوتوهار ومناطق غوجرانوالا في باكستان، على التوالي. قد يكون الاختلاف
الجدول 7 ارتباط الحالة التعليمية ومستوى الوعي لدى المزارعين مع انتشار حمى البروسيلا
المجموعات إجمالي العينات (ن) العينات الإيجابية (ن) العينات السلبية (ن) % معدل الانتشار (95% CI) قيمة P OR OR(95% CI)
أدنى أعلى
الحالة التعليمية للمزارعين
المتوسطة 350 50 300 14.28 (10.90-18.45) 0.001 11.52 4.37 1.86 12.98
فوق المتوسطة 140 5 135 3.57 (1.41-7.96)
الوعي حول حمى البروسيلا
نعم 120 6 114 5.00 (2.20-10.52) 0.013 6.179 0.35 0.13 0.79
لا 370 49 321 13.24 (10.03-17.09)
يمكن أن يُعزى ذلك إلى توفر مناخ ملائم للبكتيريا التي يمكن أن تستمر بشكل أفضل في الظروف المناخية الرطبة مقارنة بالمناخ الجاف [47، 48]. قد يكون الاختلاف أيضًا مرتبطًا بالاختلافات في ممارسات التربية، وتقنيات التشخيص المستخدمة وكثافة/حجم القطيع في مناطق مختلفة. أظهرت نتائجنا اختلافًا غير ذي دلالة في انتشار حمى البروسيلا البقرية حسب التحصيل، ومع ذلك تم الإبلاغ عن معدلات انتشار أقل نسبيًا في بانو [49] وتم الإبلاغ عن انتشار في الماشية و في الجاموس في راولبندي وإسلام آباد [50]. قد يُعزى الاختلاف في معدلات الانتشار في أجزاء مختلفة من العالم إلى الاختلافات في الظروف الجغرافية والمناخية.
من المعروف جيدًا أن الحيوانات الناضجة جنسيًا تبقى في خطر مرتفع للإصابة بحمى البروسيلا [45]. قد يكون ذلك بسبب زيادة القابلية تحت تأثير الهرمونات الجنسية وارتفاع مستويات الإريثريتول والسوائل الجنينية في المشيمة مما يؤدي إلى تحفيز نمو وتكاثر البكتيريا في الأعضاء التناسلية [51، 52]. ومع ذلك، قد تصاب الحيوانات الصغيرة أيضًا أثناء تغذيتها على الحليب الملوث من الأمهات المصابة. في دراستنا، أظهر التحليل أن ارتباط الفئات العمرية المختلفة مع انتشار حمى البروسيلا في المجترات الكبيرة كان غير ذي دلالة. تتفق نتائجنا مع تلك الخاصة بسما وآخرون [51] وجميل وآخرون [26] ولكنها تتعارض مع بعض الدراسات السابقة الأخرى [27، 46، 53، 54]. قد يكون الاختلاف في نتائج الدراسات المختلفة أيضًا بسبب عدم التناسق في تصنيف الحيوانات في فئات عمرية مختلفة. في هذه الدراسة، تم تحديد ارتباط وزن الجسم الحي مع انتشار حمى البروسيلا البقرية أيضًا على أنه غير ذي دلالة. لم يتم الإبلاغ عن مثل هذا الارتباط سابقًا. قد تكون الأوزان المنخفضة مرتبطة بحالة سوء التغذية وبالتالي ضعف مناعة الحيوانات، مما قد يكون أحد الأسباب المحتملة وراء ارتفاع معدل الانتشار في الحيوانات ذات الوزن الجسم الأقل [55]. من ناحية أخرى، تم الإبلاغ عن حمى البروسيلا أيضًا كسبب لتقليل زيادة الوزن في الحيوانات المتأثرة [23]. لوحظ ارتباط غير ذي دلالة للجنس مع انتشار حمى البروسيلا في سكان الأبقار في منطقة الدراسة.
تتفق نتائجنا مع نتائج سما وآخرون [51] وخان وآخرون [46] الذين أبلغوا أيضًا عن اختلاف غير ذي دلالة في انتشار حمى البروسيلا حسب الجنس في المجترات الكبيرة. على العكس، تم الإبلاغ عن ارتباط كبير أيضًا بين جنس الحيوان وحمى البروسيلا مع معدلات انتشار أعلى بشكل ملحوظ في الإناث [53، 56]. في منطقة الدراسة، يحتفظ المزارعون فقط بالعجول الإناث لإنتاج الحليب وللحصول على نسل جديد بينما يتم بيع الذكور/ذبحهم في سن مبكرة، لذا يمكننا جمع عدد أقل نسبيًا من عينات المصل من الذكور مقارنة بالإناث. وبناءً عليه، قد يكون الارتباط غير ذي دلالة في دراستنا بسبب حجم العينة الأصغر نسبيًا من الحيوانات الذكورية. في دراستنا، تم تسجيل ارتباط كبير ( ) بين انتشار حمى البروسيلا وسلالات المجترات الكبيرة. لوحظ أن سلالات الماشية المحلية (ساهيوال) وسلالات الجاموس (نيلي رافي) أظهرت أدنى معدل انتشار لحمى البروسيلا. من ناحية أخرى، أظهرت السلالات غير الوصفية أعلى معدلات انتشار في كل من سكان الماشية والجاموس. سابقًا، أفاد باتيل وآخرون [54]، هولت وآخرون [8] وسما وآخرون [51] أيضًا بوجود ارتباط إيجابي بين سلالات الحيوانات وانتشار حمى البروسيلا في الأبقار. قد تكون المعدلات المنخفضة لانتشار السلالات المحلية مرتبطة بقدرتها الأفضل على التكيف مع الظروف الجغرافية والمناخية المحلية والمقاومة الوراثية للأمراض المستوطنة بما في ذلك حمى البروسيلا. وقد اقترح ذلك أن يتم وضع سياسات تربية دقيقة من أجل السيطرة الفعالة على الأمراض المستوطنة. أظهرت نتائجنا وجود ارتباط إيجابي بين انتشار حمى البروسيلا وحجم القطيع من المجترات الكبيرة. أظهرت القطعان متوسطة الحجم التي تحتوي على 11-100 رأس من الماشية معدل انتشار أقل بشكل ملحوظ مقارنة بالقطعان الكبيرة أو الصغيرة. سابقًا، أفاد ديكا وآخرون [57] وأولاخ وآخرون [58] أيضًا بنفس النتائج. على العكس، أفاد خان وآخرون [59] وعلي وآخرون [45] بوجود ارتباط غير ذي دلالة بين حجم القطيع وانتشار حمى البروسيلا البقرية. في دراستنا، قد يكون ارتفاع معدل الانتشار في القطعان الصغيرة مرتبطًا بممارسات التربية السيئة بالإضافة إلى نقص الوعي لدى المزارعين حول المرض. من ناحية أخرى، في القطعان الكبيرة، قد يكون ذلك بسبب الاستبدال العشوائي للقطيع من مصادر غير معروفة دون اتباع بروتوكولات الحجر الصحي
مع الفحص غير المناسب للمرض، والنظافة والإدارة [14، 59]. في هذه الدراسة، لم يتم العثور على ارتباط بين انتشار حمى البروسيلا وعدد الولادات في المجترات الكبيرة. سابقًا، أفاد دينكا وآخرون [60] وخان وآخرون [59] أيضًا بنفس النتائج. ومع ذلك، تم الإبلاغ عن اختلاف كبير في انتشار حمى البروسيلا في الماشية التي ليس لديها، أو لديها ولادة واحدة أو ولادات متعددة [53].
تم تسجيل ارتباط غير ذي دلالة لحمى البروسيلا مع حالة الحمل في هذه الدراسة. سابقًا، تم الإبلاغ عن ارتباط غير ذي دلالة بين الحمل وحمى البروسيلا في الماشية [53]. ومع ذلك، أفاد خان وآخرون [50] أن حالة الحمل تعتبر محدد خطر محتمل لحمى البروسيلا البقرية في الماشية الحلوب التي تربى في نظام الإنتاج شبه الحضري في مناطق مختلفة من بنجاب-باكستان. قد يكون الاختلاف في دراستنا بسبب الاختلافات في السلالة، وممارسات التربية والظروف الجغرافية والمناخية لمنطقة الدراسة. كما أظهرت نتائجنا ارتباطًا غير ذي دلالة لحالة البلوغ لدى المجترات الإناث مع حمى البروسيلا. يمكن أن نفترض أن الحيوانات الصغيرة أكثر مقاومة لعدوى بروسيلا، ويرجع ذلك أساسًا إلى المناعة السلبية. قد يكون ذلك أيضًا بسبب العدوى الكامنة في العجول التي قد لا تؤدي إلى تحويل مصل أو أعراض سريرية حتى تصل إلى سن البلوغ أو النضج الجنسي. ومع ذلك، فإن الظاهرة الدقيقة معقدة ولا تزال بحاجة إلى استكشاف [61].
كانت بروتوكولات التلقيح دائمًا موضوعًا مهمًا فيما يتعلق بالأمراض المنقولة جنسيًا. في منطقة دراستنا، كان معظم المزارعين يمارسون التلقيح الطبيعي لتلقيح حيواناتهم الإناث وأظهرت النتائج ارتفاعًا كبيرًا في انتشار حمى البروسيلا في إناث المجترات الكبيرة التي تم تلقيحها من خلال التلقيح الطبيعي، ومع ذلك، كان الاختلاف غير ذي دلالة بشكل خاص في حالة الجاموس، في وقت سابق، أفاد ديكا وآخرون [57] أيضًا بوجود انتشار أقل بشكل ملحوظ في الحيوانات الأليفة التي تم اعتماد بروتوكول التلقيح الاصطناعي لأغراض التربية. من ناحية أخرى، تم الإبلاغ عن ارتباط غير ذي دلالة لطريقة التلقيح مع داء البروسيلات في سكان الجاموس من قبل باتيستيا وآخرون [62] وهذا يتماشى مع نتائجنا في سكان الجاموس. في دراسة سابقة على قطعان كولومبية، تم الإبلاغ عن أن المزارع التي تعتمد على التربية الطبيعية مع الثيران من قطعان غير معتمدة أظهرت انتشارًا أعلى بشكل ملحوظ لداء البروسيلات البقري مقارنة بتلك التي تستخدم التلقيح الاصطناعي [63]. في البيئات ذات الدخل المتوسط والمنخفض، يتم تربية الحيوانات في الغالب من خلال التربية الطبيعية ولا توجد إجراءات تشغيل قياسية لتقييم وتصديق حالة خلوها من بروسيلة. وبالمثل، فإن السائل المنوي الذي يتم جمعه في وحدات إنتاج السائل المنوي أو المزارع التابعة لا يخضع أيضًا لفحوصات صارمة لمراقبة الجودة. وهذا يبرز الحاجة إلى إدخال مفهوم الفحص الروتيني للثيران المستخدمة في التربية للأمراض المنقولة جنسيًا يتبعه تصديقها.
بالإضافة إلى ذلك، يجب أيضًا وضع بروتوكولات صارمة لمراقبة الجودة/التأكيد للسائل المنوي المستخدم في التلقيح الاصطناعي لتجنب انتقال الأمراض المنقولة جنسيًا من خلال التلقيح الاصطناعي.
في السكان الإناث، تم تحديد ارتباط داء البروسيلات مع الاضطرابات التناسلية بما في ذلك تاريخ الإجهاض، وتكرار التزاوج، واحتباس الأغشية الجنينية. كشفت النتائج عن ارتباط ملحوظ لداء البروسيلات مع جميع هذه الاضطرابات التناسلية ( ) في كل من سكان الأبقار والجاموس. مثل نتائجنا، أفادت دراسات سابقة متعددة أيضًا بوجود ارتباط ملحوظ بين الاضطرابات التناسلية وانتشار داء البروسيلات في الأبقار [27، 46، 53]. على العكس من ذلك، أفاد باتيل وآخرون [54] بوجود ارتباط غير ذي دلالة لتكرار التزاوج وأفاد خان وآخرون [48] بوجود ارتباط غير ذي دلالة لاحتباس الأغشية الجنينية مع داء البروسيلات في الأبقار. نظرًا لأن هذه المشاكل التناسلية هي علامات أساسية لداء البروسيلات، فإن هذه النتائج ليست مفاجئة. ومع ذلك، في منطقة دراستنا، قد يكون الانتشار العالي مرتبطًا بسلوك المزارعين بعدم استبعاد الحيوانات المصابة، وإدخال حيوانات جديدة في المخزون القائم دون فحص وحجر صحي، وزيادة الميل نحو التربية الطبيعية، ونقص الوعي بالمرض. بسبب ذلك، هناك تهديد متزايد لانتقال العدوى في السكان الأصحاء من خلال البيئة الملوثة من خلال إفراز بكتيريا بروسيلة مع الأجنة المجهضة، والسوائل التناسلية، والأغشية الجنينية المحتبسة للحيوانات المصابة. هذه أيضًا حالة مقلقة تتوقع الآثار zoonotic لداء البروسيلات كخطر صحي مهني للأشخاص الذين يتعاملون مع الحيوانات. تم العثور على الحالة التعليمية ومستوى الوعي لديهم حول داء البروسيلات البقري مرتبطين بشكل ملحوظ مع انتشار داء البروسيلات في المجترات الكبيرة. كانت الحيوانات التي يربيها المزارعون ذوو الحالة التعليمية الضعيفة ونقص الوعي حول المرض لديها معدلات انتشار أعلى بشكل ملحوظ ( ) لداء البروسيلات. وبالمثل، أفاد عارف وآخرون [64] أيضًا بوجود انتشار أقل بشكل ملحوظ لداء البروسيلات في مزارع الأبقار والجاموس التي يمتلكها أصحاب تعليمهم جامعي/تقني مقارنة بأولئك الذين لديهم تعليم ابتدائي/ثانوي. كما تم الإبلاغ عن أن المزارعين ذوي الحالة التعليمية الضعيفة لم يكن لديهم معرفة/محدودة حول داء البروسيلات مقارنة بالمتعلمين. قد يُعتبر ذلك سببًا محتملاً وراء ارتفاع انتشار داء البروسيلات في حيوانات المزارعين الذين لم يكن لديهم وعي حول داء البروسيلات. وبناءً عليه، فإن المزارعين ذوي الحالة التعليمية الضعيفة هم أكثر عرضة للإصابة بداء البروسيلات كخطر مهني. كما أفاد الشمحي وآخرون [17] أن البشر الذين تم تشخيصهم بداء البروسيلات في اليمن كانوا ذوي مستوى تعليمي أقل مقارنة بالمجموعة الضابطة. وهذا يستدعي الحاجة إلى إجراء حملات توعية حول داء البروسيلات لتجنب انتقاله من حيوان إلى آخر ومن الحيوان إلى الإنسان.
تضمنت قيود دراستنا عدم وجود إطار بيانات محدد جيدًا يتعلق بعدد حيازات الماشية وتربية الأبقار/الجاموس بطريقة متفرقة في كل من المزارع المنظمة والصغيرة مع وجود عدد كبير من السكان غير المسجلين في منطقة الدراسة، مما قد يؤدي إلى انحياز في الاختيار. للتخفيف من هذه القيود، تعاوننا مع إدارة تنمية الثروة الحيوانية والألبان في حكومة البنجاب لتضمين الحيوانات من كل من المزارع المنظمة والمزارع الصغيرة في جميع أنحاء منطقة الدراسة.

الاستنتاجات والتوصيات

في الختام، يعتبر داء البروسيلات البقري متوطنًا في المجترات الكبيرة في منطقة ملتان من جنوب البنجاب، باكستان. بالنظر إلى كفاءة الفحص الأولي القابلة للمقارنة، فإن مستضد RBPT المصنع محليًا له مزايا على كواشف RBPT المستوردة لكونه أرخص وبالتالي أداة فحص أكثر اقتصادية. كشفت التحليلات الجزيئية عن توطن كل من B. abortus وB. melitensis في منطقة الدراسة. كان لحجم القطيع، والسلالة، والاضطرابات التناسلية، وطريقة التلقيح، والحالة التعليمية للمزارعين، ونقص الوعي لدى المزارعين حول المرض ارتباطات ملحوظة مع داء البروسيلات البقري في منطقة الدراسة. يُوصى بوضع وتنفيذ استراتيجيات فعالة للسيطرة على داء البروسيلات تشمل (i) مراقبة نشطة للمرض، (ii) حملات توعية من خلال وسائل الإعلام المطبوعة والإلكترونية، (iii) ضمان جودة السائل المنوي المستخدم في التلقيح الاصطناعي، (iv) بناء قدرات المختبرات التشخيصية للتشخيص الدقيق وفي الوقت المناسب لداء البروسيلات و(v) التطعيم الروتيني ضد بروسيلة في المناطق المتوطنة. علاوة على ذلك، فإن الوضع الحالي يستدعي أيضًا الحاجة إلى تعزيز التنسيق بين التخصصات بين المهنيين في مجال الثروة الحيوانية وصحة الإنسان من منظور الصحة الواحدة لضمان وتعزيز أنظمة الرعاية الصحية للإنسان والحيوان في المجتمع.

طرق

منطقة الدراسة والسكان المستهدفون

تم إجراء هذه الدراسة من أكتوبر 2020 إلى سبتمبر 2021 في المجترات الكبيرة (الأبقار والجاموس) الواقعة في المناطق شبه الحضرية والريفية في منطقة ملتان في باكستان، الواقعة على ضفاف نهر تشيناب (الشكل 1). تقع بين و على ارتفاع 215 م (740 قدم) فوق مستوى سطح البحر. إنها واحدة من أكبر المناطق في جنوب البنجاب، باكستان، بمساحة . تتمتع منطقة الدراسة بظروف مناخية قاسية. في الصيف، ترتفع درجة حرارتها إلى (الحد الأقصى) وفي الشتاء تنخفض إلى (الحد الأدنى). متوسط هطول الأمطار هو 127 مم. (http://www.mda.gop.pk/aboutmultan_menu.php; تم تقييمه في 19 يوليو 2020).

تصميم الدراسة وحجم العينة

تم استخدام تقنية أخذ العينات الطبقية لجمع العينات من منطقة الدراسة. تم تقسيم السكان المستهدفين إلى طبقتين هما الأبقار والجاموس، وتم حساب حجم العينة من كل طبقة باستخدام الصيغة [65] كما يلي:
حيث، عدد العينات؛ (مستوى ثقة 95%)؛ مستوى الدقة (5%) و الانتشار المتوقع (ثابت عند 20%)
باستخدام الصيغة أعلاه، تم حساب حجم العينة لكل طبقة على أنه 245. وبناءً عليه، تم جمع إجمالي 490 عينة دم من كل من سكان الأبقار والجاموس في منطقة الدراسة.

أخذ عينات الدم

لأخذ عينات الدم، تم الاقتراب من مربي الماشية الواقعة في المناطق شبه الحضرية والريفية في منطقة ملتان بمساعدة إدارة تنمية الثروة الحيوانية والألبان، قسم ملتان، حكومة البنجاب. بعد التقييد المناسب، تم جمع عينة دم (5 مل) بشكل معقم من الوريد الوداجي لكل حيوان. من الإجمالي، تم نقل 3 مل من الدم إلى أنابيب جل ومفعّل للتخثر مسبقة التسمية (BIO-VAC، الهند) لفصل عينات المصل، وتم إضافة 2 مل إلى أنابيب مغطاة بحمض الإيثيلين ثنائي الأمين (EDTA) (Xinle Medical، الصين) لاستخراج الحمض النووي من الحيوانات الإيجابية للفيروس. تم نقل جميع العينات إلى مختبر أبحاث الصحة الواحدة، قسم علم الأمراض، كلية العلوم البيطرية، جامعة باهاء الدين زكريا، ملتان-باكستان حيث تم فصل المصل في حاويات مصل مسبقة التسمية وتم تخزينها عند وتم تخزين عينات الدم عند حتى الاستخدام لاحقًا.

جمع البيانات الوبائية الوصفية

تم جمع البيانات الوبائية الوصفية المتعلقة بالعوامل المهيئة بما في ذلك (العمر، السلالة، الجنس، وزن الجسم، تاريخ الإجهاض، تكرار التزاوج، بقاء الأغشية الجنينية، الحالة الفسيولوجية، المستوى التعليمي لمربي الماشية، حجم القطيع، البلوغ، طريقة التلقيح، إلخ) باستخدام استبيان مصمم بشكل جيد.

فحص حمى المالطية باستخدام اختبار لوحة روز بنغال (RBPT)

تم إخضاع جميع عينات المصل المجمعة للفحص الأولي بواسطة اختبار التفاعل المناعي السريع باستخدام ثلاثة مواد كيميائية متاحة تجارياً لاختبار التفاعل المناعي السريع وهي: i). مستضد اختبار التفاعل المناعي السريع، معهد البحوث البيطرية (VRI)، لاهور، باكستان، ii). روز بنغال (مستضد التكتل السريع على الشريحة)، (ID.vet ، فرنسا؛ رقم الكتالوج RSA-RB) و iii). بوركيه روز بنغال
الشكل 1 خريطة منطقة الدراسة توضح مختلف التهسيلي في منطقة ملتان – باكستان. تم تطوير خريطة الدراسة باستخدام برنامج QGIS (الإصدار 3.24.2)
Ag (IDEXX، الولايات المتحدة الأمريكية؛ الرقم المرجعي P00215). تم إجراء جميع الاختبارات وفقًا لتعليمات الشركات المصنعة لمستحضرات RBPT. باختصار، لكل مستحضر RBPT، تم استخدام مستضد بروسيلة ( ) تم خلطه مع حجم متساوٍ من المصل تلاه الاهتزاز لمدة تم اعتبار المصل الذي أظهر تشكيل منطقة تكتل واضحة (بقطر حوالي 2 سم) إيجابيًا، بينما تم اعتبار المصل الذي لم يظهر تكتل سلبيًا. كما تم استخدام الضوابط الإيجابية والسلبية المعروفة مع كل جلسة اختبار/دفعة كمرجع.

الكشف المصلي عن البروسيلا باستخدام مجموعة ELISA غير المباشرة متعددة الأنواع

تم تحليل جميع العينات المجمعة باستخدام مجموعة ELISA المتاحة تجارياً (ID-Screen) مصل البروسيلات غير المباشر متعدد الأنواع؛ رقم المنتج # BRUS-MS-10P؛ ID. فيت ، فرنسا) لتحديد انتشار الأجسام المضادة لمرض البروسيلا في السكان المستهدفين. تحتوي مجموعة ELISA على حساسية 100% و الخصوصية كما أبلغ عنها المصنع. تم إجراء الاختبار وفقًا لتعليمات المصنع. تم فحص الألواح باستخدام قارئ ألواح ELISA (ELx800، BioTek، الولايات المتحدة الأمريكية) عند 450 نانومتر وتم تفسير البيانات باستخدام برنامج تحليل البيانات ID. Soft Ver 5.11.6 (ID. Vet، فرنسا).

الكشف الجزيئي عن أنواع البروسيلة بواسطة تفاعل البوليميراز المتسلسل (PCR)

تم استخراج الحمض النووي الجيني من العينات الإيجابية للفيروس باستخدام مجموعة تنقية الحمض النووي الجيني GeneJET المتاحة تجارياً (ThermoFisher Scientific؛ رقم الكتالوج K0721) وفقاً لتعليمات الشركة المصنعة. تم إخضاع جميع العينات الإيجابية لاختبار ELISA لعملية الاستخراج و
تكبير الجينوم البكتيري لاكتشاف أنواع بروسيلة (B.) مثل B. abortus و B. melitensis باستخدام بادئات محددة للنوع والجنس. تم استخدام بادئات محددة لجنس بروسيلة مع بادئ أمامي (5′ إلى 3′) G CTCGGTTGCCAATATCAATGC وبادئ عكسي (3′ إلى 5′) GGGTAAAGCGTCGCCAGAAG بحجم منتج يبلغ 151 نقطة أساسية؛ بالنسبة لـ B. abortus، بادئ أمامي GCGGCT TTTCTATCACGGTATTC وبادئ عكسي CATGC GCTATGATCTGGTTACG بحجم منتج يبلغ 136 نقطة أساسية، وبالنسبة لـ B. melitensis، بادئ أمامي AACAAGCGGCA CCCCTAAAA وبادئ عكسي CATGCGCTATGA TCTGGTTACG بحجم منتج يبلغ 279 نقطة أساسية تم استخدامها للتكبير [66]. تم رؤية أشرطة الأمبليكون كما هو موضح بواسطة جهاز الإضاءة فوق البنفسجية (الشكل 2a-c). بالنسبة لتفاعل PCR، إجمالي خليط التفاعل الذي يحتوي على DreamTaq PCRMaster Mix ) (ثيرمو فيشر، ليتوانيا)، 2 من (10 بيكومول) من كل بادئ، من الحمض النووي المستخرج و تم تحضير من الماء المنزوع الأيونات الخالي من DNase. كانت المجموعة الضابطة السلبية عبارة عن خليط تفاعل بدون DNA. تم إجراء التضخيم والكشف عن الفلورية في الوقت الحقيقي باستخدام جهاز دورة حرارية (MultiGene Optimax، Labnet International، الولايات المتحدة الأمريكية). كانت ظروف التفاعل كما يلي: الت denaturation الأولي لمدة 10 دقائق عند ، تليها 35 دورة من لـ (لنوع بروسيلة) و (لـ B. Abortus و B. melitensis) لمدة 30 ثانية، و لمدة دقيقة واحدة وتمديد نهائي لمدة 5 دقائق عند تم إجراء تفاعل البلمرة المتسلسل المعزز على منتج PCR باستخدام هلام الأجاروز بتركيز 1.8% يحتوي على بروميد الإيثيديوم كعامل صبغ، تلاه تصور الأشرطة المطلوبة باستخدام جهاز الإضاءة فوق البنفسجية (MS Major Science، الولايات المتحدة الأمريكية).
الشكل 2 أ-ج صورة الجل توضح أ) أشرطة من جنس بروسيلا (151 نقطة أساسية)، ب) ب. أبورتوس (136) و ج) ب. ميليتينسيس (279) في منتج PCR بواسطة الرحلان الكهربائي في هلام الأجاروز

التحليل الإحصائي

تم إدخال البيانات التي تم جمعها من الاستبيانات والتحليلات المخبرية في جدول بيانات Microsoft Excel (Microsoft Office 365) وتم تقييم ارتباط إيجابية داء البروسيلات بالمتغيرات المستقلة بما في ذلك النوع، الموقع، العمر، الجنس، حجم القطيع، السلالة، عدد الولادات، حالة الحمل والبلوغ، طريقة التلقيح، نظام الزراعة، المستوى التعليمي للمزارع، وعي المزارعين بشأن داء البروسيلات، تاريخ الإجهاض، احتباس الأغشية الجنينية، وتكرار التزاوج. تم تحليل هذه الارتباطات إحصائيًا باستخدام اختبارات مختلفة مثل اختبار كاي تربيع لبييرسون، ونسبة الأرجحية، وفواصل الثقة (95%) باستخدام Minitab (الإصدار 19) وR (الإصدار 4.2.0) مع R Studio (الإصدار 2022.02.3+492) كواجهة. اعتبرت الفروقات بين المتغيرات ذات دلالة إحصائية عند .

شكر وتقدير

يُعرب المؤلفون عن شكرهم العميق لمديرية تطوير الثروة الحيوانية والألبان (قسم ملتان) على دعمهم في الوصول إلى مربي الماشية لجمع عينات الدم والبيانات الوبائية الوصفية.

مساهمات المؤلفين

تصور MMA وMA وMIA الفكرة، وصمموا الدراسة وفازوا بمنحة البحث لإجراء هذا العمل البحثي. قام MMA وGK وMIA وMAA وMSB بإجراء مسح ميداني لجمع العينات والبيانات الوبائية الوصفية. قام MMA وGK وASAKS وAR بإجراء التحليل في المختبر. ساعد GK وMMA وASAKS وAR وZF في تصميم الدراسة وأجروا التحليل الإحصائي. أعد MMA وMA وGK مسودة المخطوطة. قام MMA وGK وASAKS بمراجعة المخطوطة كما اقترح المراجعون. قرأ جميع المؤلفين ووافقوا على النسخة النهائية.

تمويل

تم دعم هذا العمل مالياً من قبل برنامج الروابط الزراعية، المجلس الزراعي الباكستاني، حكومة باكستان، إسلام آباد بموجب المنحة رقم AS 173. (رقم F. No. 3-141/2019 (ALP)-P&DD-PARC بتاريخ 09-10-2020).

توفر البيانات

البيانات التي تدعم نتائج هذه الدراسة متاحة عند الطلب المعقول من المؤلف المراسل.

الإعلانات

تمت الموافقة على الدراسة من قبل لجنة الأخلاقيات المؤسسية (FVS/AWEC004/2020) ومجلس الدراسات في قسم علم الأمراض البيولوجية، كلية العلوم البيطرية (FVS) تلاها مجلس الدراسات العليا والبحث في جامعة باهاء الدين زكريا (BZU)، ملتان-باكستان (بموجب رقم Acad/M. Phil/FVS/1535) لقضايا الأخلاق. تم الحصول على موافقة خطية مسبقة من مربي الماشية لاستخدام البيانات الناتجة عن تحليل عينات الدم/المصل من حيواناتهم لأغراض أكاديمية وبحثية ونشر دون الكشف عن هوياتهم.
تم تنفيذ جميع الطرق وفقًا للإرشادات المؤسسية المتعلقة بالتعامل الإنساني وأخذ العينات من الحيوانات.
غير قابل للتطبيق.

المصالح المتنافسة

يعلن المؤلفون عدم وجود مصالح متنافسة.

تفاصيل المؤلف

¹مختبر أبحاث الصحة الواحدة، قسم علم الأمراض، كلية العلوم البيطرية، جامعة باهاء الدين زكريا، ملتان، باكستان قسم علوم الحيوان، المجلس الباكستاني للبحوث الزراعية، إسلام آباد، باكستان
قسم العلوم السريرية، كلية العلوم البيطرية، جامعة باهاء الدين زكريا، ملتان، باكستان
إدارة تنمية الثروة الحيوانية والألبان، مديرية قسم ملتان، ملتان، باكستان
تاريخ الاستلام: 13 سبتمبر 2023 / تاريخ القبول: 15 يناير 2024
نُشر على الإنترنت: 31 يناير 2024

References

  1. Ullah Q, Jamil T, Melzer F, Saqib M, Hussain MH, Aslam MA et al. Epidemiology and Associated Risk factors for brucellosis in small ruminants kept at Institutional Livestock Farms in Punjab, Pakistan. Front Veterinary Sci. 2020;7(526).
  2. Dahourou LD, Ouoba LB, Minoungou L-BG, Tapsoba ARS, Savadogo M, Yougbaré B , et al. Prevalence and factors associated with brucellosis and tuberculosis in cattle from extensive husbandry systems in Sahel and HautsBassins regions, Burkina Faso. Sci Afr. 2023;19:e01570.
  3. González-Espinoza G, Arce-Gorvel V, Mémet S, Gorvel J-P. Brucella: reservoirs and niches in animals and humans. Pathogens. 2021;10(2):186.
  4. Corbel MJ. Brucellosis: epidemiology and prevalence worldwide. Brucellosis: clinical and laboratory aspects. CRC Press; 2020. pp. 25-40.
  5. Dean AS, Crump L, Greter H, Hattendorf J, Schelling E, Zinsstag J. Clinical manifestations of human brucellosis: a systematic review and meta-analysis. PLoS Negl Trop Dis. 2012;6(12):e1929.
  6. Ibrahim M, Schelling E, Zinsstag J, Hattendorf J, Andargie E, Tschopp R. Sero-prevalence of brucellosis, Q-fever and Rift Valley fever in humans and livestock in Somali Region, Ethiopia. PLoS Negl Trop Dis. 2021;15(1):e0008100.
  7. Edao BM, Ameni G, Assefa Z, Berg S, Whatmore AM, Wood JL. Brucellosis in ruminants and pastoralists in Borena, Southern Ethiopia. PLoS Negl Trop Dis. 2020;14(7):e0008461.
  8. Holt HR, Bedi JS, Kaur P, Mangtani P, Sharma NS, Gill JPS, et al. Epidemiology of brucellosis in cattle and dairy farmers of rural Ludhiana, Punjab. PLoS Negl Trop Dis. 2021;15(3):e0009102.
  9. Jamil T, Kasi KK, Melzer F, Saqib M, Ullah Q, Khan MR, et al. Revisiting brucellosis in small ruminants of western Border areas in Pakistan. Pathogens. 2020;9(11):929.
  10. Nejad RB, Krecek RC, Khalaf OH, Hailat N, Arenas Gamboa AM. Brucellosis in the Middle East: current situation and a pathway forward. PLoS Negl Trop Dis. 2020;14(5):e0008071.
  11. Dadar M, Tiwari R, Sharun K, Dhama K. Importance of brucellosis control programs of livestock on the improvement of one health. Vet Q. 2021;41(1):137-51.
  12. Zeng J, Duoji C, Yuan Z, Yuzhen S, Fan W, Tian L, et al. Seroprevalence and risk factors for bovine brucellosis in domestic yaks (Bos grunniens) in Tibet, China. Trop Anim Health Prod. 2017;49(7):1339-44.
  13. Joseph OA, Oluwatoyin AV, Comfort AM, Judy S, Babalola CSI. Risk factors associated with brucellosis among slaughtered cattle: epidemiological insight from two metropolitan abattoirs in Southwestern Nigeria. Asian Pac J Trop Dis. 2015;5(9):747-53.
  14. Makita K, Fèvre EM, Waiswa C, Eisler MC, Thrusfield M, Welburn SC. Herd prevalence of bovine brucellosis and analysis of risk factors in cattle in urban and peri-urban areas of the Kampala economic zone, Uganda. BMC Vet Res. 2011;7:60.
  15. Aune K, Rhyan J, Russell R, Roffe T, Corso B. Environmental persistence of Brucella abortus in the Greater Yellowstone Area. J Wildl Manag. 2012;76:253-61.
  16. Hegazy YM, Moawad A, Osman S, Ridler A, Guitian J. Ruminant brucellosis in the Kafr El Sheikh Governorate of the Nile Delta, Egypt: prevalence of a neglected zoonosis. PLoS Negl Trop Dis. 2011;5(1):e944.
  17. AI-Shamahy H, Whitty C, Wright S. Risk factors for human brucellosis in Yemen: a case control study. Epidemiol Infect. 2000;125(2):309-13.
  18. Briones G, Iñón de lannino N, Roset M, Vigliocco A, Paulo PS, Ugalde RA. Brucella abortus cyclic beta-1,2-glucan mutants have reduced virulence in mice and are defective in intracellular replication in HeLa cells. Infect Immun. 2001;69(7):4528-35.
  19. Memish ZA, Balkhy HH. Brucellosis and international travel. J Travel Med. 2004;11(1):49-55.
  20. Seleem MN, Boyle SM, Sriranganathan N. Brucellosis: a re-emerging zoonosis. Vet Microbiol. 2010;140(3-4):392-8.
  21. Zhang N, Huang D, Wu W, Liu J, Liang F, Zhou B, et al. Animal brucellosis control or eradication programs worldwide: a systematic review of experiences and lessons learned. Prev Vet Med. 2018;160:105-15.
  22. Iqbal M, Fatmi Z, Khan MA. Brucellosis in Pakistan: a neglected zoonotic disease. JPMA The Journal of the Pakistan Medical Association. 2020;70(9):1625-6.
  23. Franc KA, Krecek RC, Häsler BN, Arenas-Gamboa AM. Brucellosis remains a neglected disease in the developing world: a call for interdisciplinary action. BMC Public Health. 2018;18(1):125.
  24. Cadmus S, Adesokan H, Stack J. The use of the milk ring test and rose bengal test in brucellosis control and eradication in Nigeria. J S Afr Vet Assoc. 2008;79(3):113-5.
  25. Roushan MR, Amiri MJ, Laly A, Mostafazadeh A, Bijani A. Follow-up standard agglutination and 2-mercaptoethanol tests in 175 clinically cured cases of human brucellosis. Int J Infect Diseases: IJID: Official Publication Int Soc Infect Dis. 2010;14(3):e250-3.
  26. Jamil T, Melzer F, Saqib M, Shahzad A, Khan Kasi K, Hammad Hussain M, et al. Serological and Molecular Detection of Bovine Brucellosis at Institutional Livestock Farms in Punjab, Pakistan. Int J Environ Res Public Health. 2020;17(4):1412.
  27. Khan AU, Melzer F, Hendam A, Sayour AE, Khan I, Elschner MC et al. Seroprevalence and Molecular Identification of Brucella spp. in bovines in Pakistan-investigating Association with risk factors using machine learning. Front Vet Sci. 2020;7.
  28. Baig S. Seroprevalence of bovine brucellosis and analysis of risk factors in cattle and livestock Handler’s in Gilgit – Pakistan, 2019. Int J Infect Dis. 2020;101:534.
  29. Villanueva MA, Mingala CN, Tubalinal GAS, Gaban PBV, Nakajima C, Suzuki Y. Emerging infectious diseases in water buffalo: An economic and public health concern. Emerging Infectious Diseases in Water Buffalo-An Economic and Public Health Concern. 2018.
  30. Pudake R, Jain U, Kole C, Shakya S, Saxena K. Nano-Biosensing Devices Detecting Biomarkers of Communicable and Non-communicable Diseases of Animals. Biosensors in Agriculture: Recent Trends and Future Perspectives. 2020:415-34.
  31. Deresa B, Tulu D, Deressa FB. Epidemiological Investigation of Cattle Abortion and Its Association with brucellosis in Jimma Zone, Ethiopia. Veterinary Medicine: Research and Reports. 2020;11:87-98.
  32. Ukwueze KO, Ishola OO, Dairo MD, Awosanya EJ, Cadmus SI. Seroprevalence of brucellosis and associated factors among livestock slaughtered in OkoOba abattoir, Lagos State, southwestern Nigeria. Pan Afr Med J. 2020;36(1):53.
  33. Ntivuguruzwa JB, Kolo FB, Gashururu RS, Umurerwa L, Byaruhanga C, van Heerden H. Seroprevalence and Associated Risk factors of bovine brucellosis at the Wildlife-Livestock-Human interface in Rwanda. Microorganisms. 2020;8(10):1553.
  34. Fero E, Juma A, Koni A, Boci J, Kirandjiski T, Connor R, et al. The seroprevalence of brucellosis and molecular characterization of Brucella species circulating in the beef cattle herds in Albania. PLoS ONE. 2020;15(3):e0229741.
  35. Shrimali M, Patel S, Chauhan H, Chandel B, Patel A, Sharma K, et al. Seroprevalence of brucellosis in bovine. Int J Curr Microbiol App Sci. 2019;8(11):1730-7.
  36. Madut NA, Muwonge A, Nasinyama GW, Muma JB, Godfroid J, Jubara AS, et al. The sero-prevalence of brucellosis in cattle and their herders in Bahr El Ghazal region, South Sudan. PLoS Negl Trop Dis. 2018;12(6):e0006456.
  37. Pathak AD, Dubal ZB, Karunakaran M, Doijad SP, Raorane AV, Dhuri RB et al. Apparent seroprevalence, isolation and identification of risk factors for brucellosis among dairy cattle in Goa, India. Comparative immunology, microbiology and infectious diseases. 2016;47:1-6.
  38. Asgedom H, Damena D, Duguma R. Seroprevalence of bovine brucellosis and associated risk factors in and around Alage district. Ethiopia SpringerPlus. 2016;5(1):1-8.
  39. Awah-Ndukum J, Mouiche MMM, Kouonmo-Ngnoyum L, Bayang HN, Manchang TK, Poueme RSN, et al. Seroprevalence and risk factors of brucellosis among slaughtered indigenous cattle, abattoir personnel and pregnant women in Ngaoundéré, Cameroon. BMC Infect Dis. 2018;18(1):611.
  40. Chaka H, Aboset G, Garoma A, Gumi B, Thys E. Cross-sectional survey of brucellosis and associated risk factors in the livestock-wildlife interface area of Nechisar National Park, Ethiopia. Trop Anim Health Prod. 2018;50(5):1041-9.
  41. Bifo H, Gugsa G, Kifleyohannes T, Abebe E, Ahmed M. Sero-prevalence and associated risk factors of bovine brucellosis in Sendafa, Oromia Special Zone surrounding Addis Ababa, Ethiopia. PLoS ONE. 2020;15(11):e0238212.
  42. Kamga RMN, Silatsa BA, Farikou O, Kuiate JR, Simo G. Detection of Brucella antibodies in domestic animals of southern Cameroon: implications for the control of brucellosis. Vet Med Sci. 2020;6(3):410-20.
  43. Yanti Y, Sumiarto B, Kusumastuti T, Panus A, Sodirun S, editors. Seroprevalence and risk factors of brucellosis and the brucellosis model at the individual level of dairy cattle in the West Bandung District, Indonesia, Veterinary World, 14 (1): 1-102021: Abstract.
  44. Boukary AR, Saegerman C, Abatih E, Fretin D, Alambédji Bada R, De Deken R, et al. Seroprevalence and potential risk factors for Brucella Spp. Infection in traditional cattle, Sheep and Goats Reared in Urban, Periurban and Rural areas of Niger. PLoS ONE. 2013;8(12):e83175.
  45. Ali S, Akhter S, Neubauer H, Melzer F, Khan I, Abatih EN, et al. Seroprevalence and risk factors associated with bovine brucellosis in the Potohar Plateau, Pakistan. BMC Res Notes. 2017;10(1):73.
  46. Khan MR, Rehman A, Khalid S, Ahmad MUD, Avais M, Sarwar M, et al. Seroprevalence and Associated Risk factors of bovine brucellosis in District Gujranwala, Punjab, Pakistan. Animals. 2021;11(6):1744.
  47. Rodriguez-Morales J. A. Climate change, climate variability and brucellosis. Recent patents on anti-infective drug discovery. 2013;8(1):4-12.
  48. Khan I, Ali S, Hussain R, Raza A, Younus M, Khan N, et al. Serosurvey and potential risk factors of brucellosis in dairy cattle in peri-urban production system in Punjab, Pakistan. Pak Vet J. 2021;41(3):459-62.
  49. Bakhtullah FP, Shahid M, Basit A, Khan MA, Gul S, Wazir I, et al. Sero-prevalence of brucellosis in cattle in southern area of Khyber Pakhtunkhwa, Pakistan. Res J Vet Pract. 2014;2(4):63-6.
  50. Ahmad T, Khan I, Razzaq S, Akhtar R. Prevalence of bovine brucellosis in Islamabad and rawalpindi districts of Pakistan. Pakistan J Zool. 2017;49(3).
  51. Sima DM, Ifa DA, Merga AL, Tola EH. Seroprevalence of bovine brucellosis and Associated Risk factors in Western Ethiopia. Veterinary Medicine: Research and Reports. 2021;12:317.
  52. Haileselassie M, Kalayou S, Kyule M, Asfaha M, Belihu K. Effect of Brucella infection on reproduction conditions of female breeding cattle and its public health significance in Western Tigray, northern Ethiopia. Veterinary medicine international. 2011;2011.
  53. Saeed U, Ali S, LatifT, Rizwan M, Iftikhar A, Ghulam Mohayud Din Hashmi S, et al. Prevalence and spatial distribution of animal brucellosis in central Punjab, Pakistan. Int J Environ Res Public Health. 2020;17(18):6903.
  54. Patel M, Patel P, Prajapati M, Kanani A, Tyagi K, Fulsoundar A. Prevalence and risk factor’s analysis of bovine brucellosis in peri-urban areas under intensive system of production in Gujarat, India. Vet World. 2014;7(7):509-16.
  55. França T, Ishikawa L, Zorzella-Pezavento S, Chiuso-Minicucci F, da Cunha MdLRdS, Sartori A. Impact of malnutrition on immunity and infection. J Venom Anim Toxins Including Trop Dis. 2009;15(3):374-90.
  56. Rahman M, Faruk M, Her M, Kim J, Kang S, Jung S. Prevalence of brucellosis in ruminants in Bangladesh. Vet Med. 2011;56(8):379-85.
  57. Deka RP, Shome R, Dohoo I, Magnusson U, Randolph DG, Lindahl JF. Seroprevalence and risk factors of Brucella infection in dairy animals in urban and rural areas of Bihar and Assam, India. Microorganisms. 2021;9(4):783.
  58. Aulakh H, Patil P, Sharma S, Kumar H, Mahajan V, Sandhu K. A study on the epidemiology of bovine brucellosis in Punjab (India) using milk-ELISA. Acta Vet Brno. 2008;77(3):393-9.
  59. Khan AU, Sayour AE, Melzer F, El-Soally SAGE, Elschner MC, Shell WS, et al. Seroprevalence and molecular identification of Brucella spp. in camels in Egypt. Microorganisms. 2020;8(7):1035.
  60. Dinka H, Chala R. Seroprevalence study of bovine brucellosis in pastoral and agro-pastoral areas of East Showa Zone, Oromia Regional State, Ethiopia. American-Eurasian J Agricultural Environ Sci. 2009;6(5):508-12.
  61. Garry F. Chapter 15 – Miscellaneous Infectious Diseases. In: Divers TJ, Peek SF, editors. Rebhun’s Diseases of Dairy Cattle (Second Edition). Saint Louis: W.B. Saunders; 2008. p. 606-39.
  62. Batista HR, Passos CTS, Nunes Neto OG, Sarturi C, Coelho APL, Moreira TR, et al. Factors associated with the prevalence of antibodies against Brucella abortus in water buffaloes from Santarém, Lower Amazon region, Brazil. Transbound Emerg Dis. 2020;67(S2):44-8.
  63. Cárdenas L, Peña M, Melo O, Casal J. Risk factors for new bovine brucellosis infections in Colombian herds. BMC Vet Res. 2019;15(1):81.
  64. Arif S, Thomson PC, Hernandez-Jover M, McGill DM, Warriach HM, Hayat K, et al. Bovine brucellosis in Pakistan; an analysis of engagement with risk factors in smallholder farmer settings. Veterinary Med Sci. 2019;5(3):390-401.
  65. Pourhoseingholi MA, Vahedi M, Rahimzadeh M. Sample size calculation in medical studies. Gastroenterol Hepatol Bed Bench. 2013;6(1):14-7.
  66. Probert WS, Schrader KN, Khuong NY, Bystrom SL, Graves MH. Real-time multiplex PCR assay for detection of <i>Brucella spp., <i>B. Abortus, and B. melitensis. J Clin Microbiol. 2004;42(3):1290-3.

ملاحظة الناشر

تظل شركة سبرينجر ناتشر محايدة فيما يتعلق بالمطالبات القضائية في الخرائط المنشورة والانتماءات المؤسسية.
  1. ساهم ميان محمد عويس وغوهر خادم بالتساوي في هذا العمل ويتشاركان في المرتبة الأولى كالمؤلفين.
    *المراسلة:
    ميان محمد عويس
    drawaisuaf@gmail.com; muhammadawais@bzu.edu.pk
    قائمة كاملة بمعلومات المؤلف متاحة في نهاية المقال

Journal: BMC Veterinary Research, Volume: 20, Issue: 1
DOI: https://doi.org/10.1186/s12917-024-03880-9
PMID: https://pubmed.ncbi.nlm.nih.gov/38297263
Publication Date: 2024-01-31

A study on the epidemiology of brucellosis in bovine population of peri-urban and rural areas of district Multan, southern Punjab, Pakistan

Mian Muhammad Awais , Gohar Khadim , Masood Akhtar , Muhammad Irfan Anwar , Abdul Sammad Ali Khan Shirwany , Ahmad Raza , Abdul Razzaq , Zahida Fatima , Muhammad Amjad Ali and Muhammad Sibtain Bhatti

Abstract

Background Brucellosis is a zoonotic disease caused by a bacterial pathogen belonging to the genus Brucella. It is one of the most frequent bacterial zoonoses globally but unfortunately, it is still considered as a neglected disease in the developing world. Keeping in view, this study was conducted to determine the prevalence and risk determinants of brucellosis in large ruminants of peri-urban and rural areas of district Multan-Pakistan. For this purpose, blood samples ( ) were collected from the cattle ( ) and buffalo ( ) population of the study area and subjected to preliminary screening of brucellosis using local and imported RBPT reagents. All the samples were further analyzed using commercially available multi-specie indirect ELISA kit followed by their confirmation by PCR using genus and species-specific primers. Data obtained from lab analysis and questionnaires were subjected to statistical analysis for Pearson Chi-square, Odds Ratio and Confidence intervals (95%). Results The results showed that the maximum seropositivity was recorded with local RBPT reagent (VRI, Pakistan; 12.45%; 95%CI=9.72-15.65%) followed by RBPT-IDEXX ( ; 95%CI=9.52-15.45%) and RBPT-ID.vet ( ; ) however statistical difference was non-significant ( ). The ELISA results showed an overall seroprevalence rate of with comparatively higher rate in cattle ( ; ) as compared to buffaloes ( ). The PCR analysis confirmed the presence of genus Brucella in all seropositive samples whereas frequency of B. abortus and B. melitensis in seropositive samples was 80% and 20%, respectively. The co-existence of both species was also observed in 5.45% samples. The statistical analysis showed a significant association of bovine brucellosis with herd size, breed, reproductive disorders,

mode of insemination, educational status and farmers’ awareness about brucellosis ( ). Conversely, locality, age, weight, gender, pregnancy status, parity and puberty status had no associations with brucellosis ( ).
Conclusion In conclusion, brucellosis is prevalent in large ruminants of district Multan, Pakistan. It is suggested to devise and implement stringent policies for the effective control and prevention of brucellosis in the region. Further, the current situation also warrants the need to strengthen interdisciplinary coordination among veterinarians and physicians in one health perspective to ensure and strengthen the human and animal health care systems in the region.
Keywords Brucellosis; prevalence, Risk determinants, i-ELISA, Molecular detection, Multan-Pakistan

Background

Brucellosis is an important bacterial disease which affects domesticated animals including ruminants, swine and dogs with zoonotic implications [1,2]. It is caused by different species of genus Brucella (B.) from which . abortus, B. melitensis, B. canis and B. suis are the most important species with respect to their zoonotic potential [3]. It has worldwide geographical distribution but more predominant in developing countries [4]. Approximately, 0.5 million people are infected by this disease annually [5]. In human beings, it is mainly transmitted by close contact with affected animals, their secretions, consumption of contaminated meat, milk and other dairy products whereas in animals, it is transmitted by direct or indirect contact of healthy and infected animals with each other causing abortion and infertility in their primary natural hosts [6, 7]. It has also been established as an occupational health hazard for livestock farmers and animal healthcare professionals [8]. In endemic regions of the world, it causes significant economic losses in livestock sector in terms of poor production performance, infertility, and abortion in affected animals. Additionally, it also exerts a negative impact on socio-economic development of affected countries by affecting the human health care systems, restrictions on trade of animals/ their products and tourism industry [1]. The low- and middle-income countries of Asia (including Pakistan), the Middle East, the Mediterranean rim (Spain, Greece, and Portugal), Central and South America and Africa are reportedly endemic for brucellosis, but some developed countries of the world have also been succeeded in preventing or eradication of this zoonotic disease by taking strict control measures [9, 10].
In the livestock industry, management, environmental and animal factors contribute to the occurrence of this disease. The management factors may include vaccination, animal handling, farm hygiene, screening of newly purchased animals, breeding practices, milking strategies, size of the herd and production systems [8,11]. On the other hand, animal factors include sex, breed, age and abortion history whereas environmental factor mainly comprise the agro-ecological location of animals [12, 13]. Literature also revealed that occurrence of this
disease is high in pastoral grazing regions as compared to urban areas [14]. Moreover, survival potential of Brucella in cold and humid environments is another important factor for the transmission of this disease in livestock and humans [15]. The human behavioral factors such as unhygienic conditions and other activities that cause the exposure of people to infected animals and their products enhances the chances of disease in humans [16]. On the whole, the farmers, abattoir, laboratory workers, and people that are involved in the livestock industry may be regarded as high risk populations [17]. The other risk factors which serve as main barriers in controlling brucellosis are conventional livestock policies, political influences, inadequate implementation of control measures, usage of old traditional practices, consumption of unpasteurized dairy products, changes in the animal husbandry system and insufficient measures for reporting, diagnosis and surveillance of this disease [10]. The appropriate treatment and prevention of this disease are indispensable to avoid economic losses in the livestock sector. The developing countries are lacking behind in implementing the eradication strategies against brucellosis [18-20]. Although the World Health Organization (WHO) and World Organization for Animal Health (WOAH) have devised recommendations for the eradication of brucellosis, but it is still considered a serious health threat in developing/underdeveloped countries because control measures for the eradication of brucellosis are expensive, laborious, and time-consuming. However, in endemic countries, its occurrence can be avoided by vaccination and slaughtering/culling strategies [21].
Due to limited diagnostic facilities, brucellosis is still considered a neglected disease in most parts of the world including Pakistan [22,23]. Due to this reason, the dynamics and zoonotic importance of disease are not fully explored to formulate any stringent strategy to overcome this important health issue. Under prevailing conditions, field veterinarians rely on Rose Bengal Plate Test (RBPT) and Milk Ring Test (MRT) for the rapid diagnosis of brucellosis in large ruminants [24]. Anyhow, it is always recommended to use RBPT with other serological tests (with high sensitivity and specificity) for an accurate diagnosis to avoid false-positive as well as false
Table 1 Screening and comparison of brucellosis using different commercially available RBPT antigens
% Seropositivity with RBPT (n/T) (95%CI) -Value
VRI IDEXX ID.vet
Overall 12.45 (61/490) (9.72-15.65) 12.24 (60/490) (9.52-15.45) 11.84 (58/490) (9.18-14.95) 0.089 0.956
Cattle 15.10 (37/245) (10.86-20.10) 15.92 (39/245) (11.70-21.03) 15.51 (38/245) (11.28-20.51) 0.062 0.969
Buffalo 9.79 (24/245) (6.49-14.15) 8.57 (21/245) (5.56-12.72) 8.16 (20/245) (5.14-12.31) 0.439 0.803
RBPT=Rose Bengal Plate Test; confidence interval; VRI Veterinary Research Institute; Chi-square
Table 2 Overall and species-wise prevalence of brucellosis using multi-species i-ELISA Kit
Large Ruminant Total samples (n) Positive samples (n) % Seroprevalence (95% CI) -Value OR OR (95% CI)
Lower Limit Upper Limit
Overall 490 55 11.22 (8.59-14.33) – – –
Cattle 245 31 12.65 (8.82-17.44) 0.316 1.004 1.33 0.76 2.37
Buffalo 245 24 9.80 (6.49-14.15)
iELISA- Indirect Enzyme linked immunosorbent assay; confidence interval; Chi square; OR=Odds Ratio
negative results [25]. So, for effective control and prevention, it is imperative to conduct studies on brucellosis using sophisticated serological and molecular diagnostic tools to generate baseline data on its prevalence and associated risk factors. In Pakistan, some previous studies have reported the prevalence and risk determinants of brucellosis in some selected districts of the country [2628], but information regarding the epidemiology of brucellosis is scarce/ limited in southern Punjab which is the hub of livestock and inhabits approximately more than of total livestock population of the province Punjab. Keeping in view, this study was conducted to assess the prevalence and associated risk factors of brucellosis in large ruminants of district Multan, Punjab-Pakistan using sero- and molecular diagnostic techniques. It is anticipated that data generated from this study will be helpful for the livestock policy/decision-making bodies to formulate effective strategies to control brucellosis in large ruminants.

Results

Screening and comparison of brucellosis using different commercially available RBPT antigens

In overall ruminant population, the maximum seropositivity was recorded with RBPT-VRI ( ; ) followed by RBPT-IDEXX ( ) and RBPT-ID.vet ( ; ). The statistical analysis revealed that difference was non-significant ( ) which indicated that all the antigens are equally good for preliminary screening. A similar trend was observed in spe-cies-wise analysis (Table 1).

Overall and species-wise prevalence of brucellosis

Results of analysis using multi-species Indirect ELISA kit showed that overall prevalence of brucellosis in large ruminants was ( ; ). In species-wise analysis, it was revealed that seroprevalence of brucellosis was comparatively higher in cattle ( ) as compared to buffalo ( ) population however difference was non-significant ( ) (Table 2).

Molecular detection of Brucella species in ELISA positive samples

The ELISA positive samples were subjected to PCR for confirmation of brucellosis and detection of Brucella species in positive samples. The results confirmed the presence of Brucella in all the ELISA positive samples using genus specific primers. On the other hand, the results of PCR using species-specific primers revealed that out of total positive samples, B. abortus was detected in ( ) large ruminants with overall prevalence of . The B. melitensis was detected in ( ) of positive samples with overall prevalence of ( ) in large ruminants. The co-prevalence of B. abortus and B. melitensis in positive samples was with an overall prevalence of ( ) in large ruminants. A similar trend was recorded in cattle and buffalo populations when analyzed separately (Table 3).

Farm/herd level and tehsil wise prevalence

In this study, a total of 67 farms located in peri-urban and rural areas of different tehsils of district Multan were
Table 3 Molecular detection of Brucella species in ELISA positive samples by Polymerase Chain Reaction
Population Brucella Spp. % (n) B. abortus (BA) % (n) B. melitensis (BM) % (n) Both BA & BM % (n)
Out of ELISA positive samples
Overall 100 (55/55) 80 (44/55) 20 (11/55) 5.45 (3/55)
Cattle 100 (31/31) 80.64 (25/31) 19.36 (06/31) 3.22 (01/31)
Buffalo 100 (24/24) 79.17 (19/24) 20.83 (5/24) 8.33 (02/24)
Out of total population
Overall 11.22 (55/490) 8.98 (44/490) 2.24 (11/490) 0.61 (03/490)
Cattle 12.65 (31/245) 10.2 (25/245) 2.45 (06/245) 0.41 (01/245)
Buffalo 9.80 (24/245) 7.76 (19/245) 2.04 (05/245) 0.82 (02/245)
sampled. While calculating farm/herd level prevalence, a herd/farm having at least one positive animal for Brucella antibodies was considered positive. Out of total, animals at 22 farms were positive for brucellosis indicating its farm level prevalence of ( ). In tehsil wise data analysis, it was revealed that farm level prevalence was highest in Tehsil Multan ( ; 95%CI=20.11-69.96%) followed by those of Shujabad ( ) and Jalalpur Pirwala (27.27; ) however the difference was non-significant ( ). In tehsil-wise analysis of prevalence of brucellosis, the highest prevalence rate ( ) was recorded in large ruminants of tehsil Multan followed by those of Shujabad ( ) and Jalalpur Pirwala ( ) however the difference was non-significant ( ). A similar trend was recorded in cattle and buffalo populations of different tehsils, when analyzed separately (Table 4).

Association of demographic parameters with the prevalence of brucellosis

Results showed highest prevalence of brucellosis in large ruminants aged years ( ; OR=1.81; 95%CI OR ) followed by those of years ( ; OR ) and but years ( ; ) whereas the statistical difference between different age groups was non-significant ( ). A similar non-significant association was recorded when age-wise data was analyzed for cattle ( ) and buffalo ( ) populations, separately. The genderwise analysis showed higher prevalence of brucellosis in females ( ) of large ruminants as compared to males (10.00%) however the difference was statistically non-significant ( ; OR ; CI OR 4.91). Similarly, a non-significant association was recorded between gender and prevalence of brucellosis in cattle ( ; OR ; CI OR ) and buffalo ( ; OR ) populations when their data was analyzed separately. In breed-wise analysis of cattle population, highest prevalence was recorded in non-descripts ( ; OR=2.08;
OR ) and the lowest prevalence was recorded in Sahiwal breed (6.49%; OR=0.56; 95%CI and the difference of prevalence between different breeds was statistically significant ( ). In buffalo population, non-descript buffaloes showed a higher prevalence rate ( ) as compared to Nili-Ravi breed (7.48%) and the difference was statistically significant ( ; OR CI OR ). Results also revealed a non-significant association ( ) between body weight and prevalence of brucellosis in large ruminants. Depending upon number of parities, data was divided into 2 groups of females viz. i). with parities and ii). having>3 parities. Analysis revealed nonsignificant association of number of parities with prevalence of brucellosis both in cattle and buffalo populations ( OR OR ). The correlation analysis of brucellosis with physiological status of females revealed slightly higher prevalence of brucellosis in pregnant females ( ) as compared to nonpregnant females ( ) whereas the difference was statistically non-significant ( ; OR ; CI ). The herd size was found to be significantly associated with prevalence of brucellosis in large ruminants ( ). Overall, the prevalence rate was highest in animals of herd size heads ( ) and lowest in animals with 11-100 heads herd size ( ; OR ). With respect to puberty status of females, a non-significant association was recorded between puberty status and prevalence of brucellosis ( ; OR ; CI OR ). Based upon insemination protocol, natural breeding (OR=3.45; OR ) was found to be significantly associated with high prevalence of brucellosis in overall large ruminants ( ). Similar trend was observed in cattle population ( ) however in case of buffaloes, difference was non-significant ( ). Results also showed that prevalence of brucellosis was higher in bovines reared at farms where small ruminants were also present as compared to those reared in exclusive large ruminant farming system; however, the difference was statistically non-significant ( ; OR ; CI OR (Table 5).
Table 4 Farm/herd level and Tehsil wise prevalence of brucellosis in large ruminants
Large Ruminants % Prevalence ( ) (95% CI) -Value OR OR(95% CI)
Lower limit Upper limit
Herd-Level
Overall 32.83 (22/67) (22.00-44.82)
Multan 43.75 (7/16) (20.11-69.96) 0.545 1.216 2.03 0.43 10.04
Shujabad 31.03 (9/29) (16.38-50.00) 1.2 0.3 5.02
Jalalpur Pirwala 27.27 (6/22) (12.60-50.00) 1
Tehsil-wise Overall large ruminants
Multan 12.07 (21/174) (7.85-17.66) 0.887 0.239 1.19 0.56 2.59
Shujabad 11.11 (19/171) (7.04-16.78) 1.08 0.5 2.39
Jalalpur Pirwala 10.34 (15/145) (5.91-16.35) 1
Cattle
Multan 15.05 (14/93) (8.77-23.94) 0.673 0.791 1.36 0.45 4.61
Shujabad 11.00 (11/100) (5.87-18.72) 0.95 0.3 3.33
Jalalpur Pirwala 11.54 (6/52) (5.14-22.66) 1
Buffalo
Multan 8.64 (7/81) (3.91-16.91) 0.862 0.298 0.88 0.27 2.82
Shujabad 11.27 (8/71) (5.01-20.76) 1.18 0.37 3.68
Jalalpur Pirwala 9.68 (9/93) (4.95-17.43) 1
confidence interval; Chi-square; odds ratio

Association of reproductive disorders with prevalence of brucellosis

Results revealed that large ruminants with abortion history showed higher prevalence rate ( ) as compared to those with no abortion history ( ) and the difference was significant ( ; OR=8.38; 95%CI ). A similar association was observed in cattle and buffalo populations when data was analyzed separately. Similarly, some other reproductive disorders like repeat breeding history ( ; 95%CI OR=1.587.03) and retention of fetal membranes (OR=6.44; 95%CI OR=2.98-13.60) also showed a significant association ( ) with prevalence of brucellosis in large ruminants of study area (Table 6).

Association of educational status and awareness level of farmers with prevalence of brucellosis

The large ruminants kept by farmers having poor educational status ( matriculation) showed higher prevalence rate (14.28%) as compared to those with educational status above matriculation ( ) and difference was
statistically significant ). Similarly, lack of awareness about brucellosis also had a significant association with prevalence of brucellosis in large ruminants ( ; OR=0.35; OR (Table 7).

Discussion

Brucellosis is an infectious disease with serious zoonotic implications affecting both animals and humans around the globe [8]. It badly affects the livestock sector and results in enormous economic losses [29]. In addition to adverse effects in the livestock industry, brucellosis is also being highlighted as a potential occupational hazard in individuals associated with the livestock sector including farmers, milkers, shepherds, veterinary healthcare professionals, abattoir workers, etc. [30]. . In Pakistan, it is an increasingly significant health issue of veterinary and public health concerns because most of the rural population relies on the livestock sector to earn their livelihood and spend most of their time in close contact with animals to raise them. In this study, seropositivity of
Table 5 Association of demographic parameters with the prevalence of brucellosis
Demographic Characters % Prevalence ( ) (95% CI) P-Value OR OR (95% CI)
Lower limit Upper limit
Age (years)
Overall
13.67 (19/139) (8.76-20.32) 2.777 0.249 1.52 0.77 0.62
years but 9.45 (29/307) (6.56-13.24) 1
More than 8 15.91 (7/44) (7.21-29.18) 1.81 0.62 4.62
Cattle
14.44 (13/90) (8.15-2308) 0.481 0.786 1.26 0.53 2.93
years but 11.80 (17/144) (7.19-18.20) 1
More than 8 9.09 (1/11) (0.46-40.11) 0.75 0.02 5.89
Buffalo
12.24 (6/49) (5.47-24.06) 4.052 0.132 1.75 0.51 5.4
years but 7.36 (12/163) (4.07-12.38) 1
More than 8 18.18 (6/33) (8.22-34.47) 2.78 0.79 2.78
Gender
Overall
Female 11.30 (52/460) (8.61-14.50) 0.048 0.826 1.10 0.37 4.91
Male 10.00 (3/30) (2.77-25.96)
Cattle
Female 12.39 (29/234) (8.61-17.19) 0.319 0.572 0.61 0.14 4.52
Male 18.18 (2/11) (3.32-50.01)
Buffalo
Female 10.17 (23/226) (6.69-14.70) 0.479 0.489 1.80 0.34 44.75
Male 5.26 (1/19) (0.26-25.17)
Breed
Cattle
Sahiwal 6.49 (5/77) (2.59-14.50) 8.382 0.039 0.56 0.11 3.01
Friesian 8.88 (4/45) (3.08-20.57) 0.78 0.13 4.55
Crossbred 11.11 (4/36) (3.88-25.77) 1
Non-descript 20.69 (18/87) (12.82-30.27) 2.08 0.61 9.12
Buffalo
Nili Ravi 7.48 (16/214) (4.50-11.76) 10.296 0.001 0.23 0.09 0.64
Non-descript 25.81 (8/31) (12.61-43.38)
Herd size (No. of heads) Overall
Table 5 (continued)
Demographic Characters % Prevalence ( ) (95% CI) P-Value OR OR(95% CI)
Lower limit Upper limit
Up to 10 26.22 (16/61) (15.86-38.37) 49.128 0.000 0.9 0.39 2.05
From 11 to 100 5.07 (18/355) (3.13-7.78) 0.14 0.06 0.29
> 100 28.38 (21/74) (18.51-39.75) 1
Cattle
Up to 10 30.00 (9/30) (15.81-48.29) 32.259 0.000 0.79 0.24 2.54
From 11 to 100 5.52 (10/181) (2.83-9.76) 0.11 0.04 0.31
> 100 35.29 (12/34) (19.99-53.02) 1
Buffalo
Up to 10 22.58 (7/31) (10.26-40.06) 18.361 0.000 1 0.27 3.54
From 11 to 100 4.60 (8/174) (2.04-8.71) 0.17 0.05 0.53
> 100 22.50 (9/40) (11.84-37.97) 1
Parity Overall
11.75 (39/332) (8.63-15.58) 0.233 0.629 1.17 0.61 2.36
>3 10.16 (13/128) (5.52-16.57)
Cattle
13.89 (25/180) (9.22-19.59) 1.607 0.205 1.95 0.71 7.05
>3 7.41 (4/54) (2.56-17.22)
Buffalo
9.21 (14/152) (5.36-14.92) 0.474 0.491 0.73 0.30 1.85
>3 12.16 (9/74) (6.26-21.31)
Pregnancy
Overall
Yes 12.24 (6/49) (5.47-24.06) 0.048 0.826 1.13 0.41 2.63
No 11.19 (46/411) (8.41-14.64)
Cattle
Yes 15.00 (3/20) (4.21-36.94) 0.137 0.711 1.32 0.28 4.34
No 12.15 (26/214) (8.24-17.16)
Buffalo
Yes 10.34 (3/29) (2.87-26.87) 0.001 0.974 1.06 0.23 3.42
No 10.15 (20/197) (6.40-15.08)
Puberty Status Overall
Table 5 (continued)
Demographic Characters % Prevalence ( ) (95% CI) P-Value OR OR(95% CI)
Lower limit Upper limit
Heifers 16.67 (11/66) (9.14-27.73) 2.210 0.137 1.73 0.80 3.49
Adults 10.41 (41/394) (7.64-13.76)
Cattle
Heifers 16.67 (5/30) (6.80-34.52) 0.579 0.447 1.53 0.47 4.14
Adults 11.76 (24/204) (7.89-16.83)
Buffalo
Heifers 16.67 (6/36) (7.51-32.03) 1.973 0.160 2.06 0.68 5.50
Adults 8.95 (17/190) (5.30-13.79)
Mode of insemination Overall
Artificial Insemination 4.55 (5/110) (1.80-10.14) 7.436 0.024 1
Natural Breeding 14.14 (41/290) (10.39-10.57) 3.45 1.31 11.50
Not Inseminated 10.00 (6/60) (4.44-20.38) 2.32 0.56 10.08
Cattle
Artificial Insemination 4.44 (4/90) (1.52-10.74) 8.814 0.012 1
Natural Breeding 18.10 (21/116) (11.78-26.1) 4.72 1.51 19.67
Not Inseminated 14.29 (4/28) (5.02-31.61) 3.53 0.61 20.50
Buffalo
Artificial Insemination 5.00 (1/20) (0.25-23.88) 1.456 0.483 1
Natural Breeding 11.49 (20/174) (7.24-17.07) 2.46 0.35 107.54
Not Inseminated 6.25 (2/32) (1.12-19.59) 1.26 0.06 78.57
Co-raising of small ruminants
No 9.19 (26/283) (6.23-13.13) 2.79 0.095 0.62 0.35 1.09
Yes 14.01 (29/207) (9.73-19.44)
brucellosis was determined with different RBPT reagents and a non-significant difference was recorded in seropositivity rates with different antigens. However, locally produced RBPT-VRI was the cheapest one and it can be effectively used as a rapid and economical screening test under local conditions. The ELISA results revealed that the prevalence of bovine brucellosis in the target population was . However, molecular characterization revealed higher prevalence of B. abortus in seropositive animals. Contrary to our findings, studies conducted in different parts of the world showed higher prevalence rates of bovine brucellosis like in Jimma zone,
Ethiopia [31], in southwestern Nigeria [32], 28.9% in Rwanda [33],, in 6 southern districts of Albania [34], in India [35], 31% in Bahr el Ghazal region of South Sudan [36], and in Goa, India [37]. However, lower prevalence rates had also been reported in some other countries such as in Alage district of Ethiopia [38], 3.40% in Ngaoundéré, Cameroon [39], 9.7% in Nechisar National Park, Ethiopia [40], 0.4% in Sendafa, Oromia Special Zone, Ethiopia [41], 6.35% in Southern Cameron [42], and in Indonesia [43]. Several factors including geographical conditions, sampling methods, breed of animals, herd size and different methods
Table 6 Association of reproductive disorders with prevalence of brucellosis
Reproductive disorders %Prevalence ( ) OR OR 95% CI P-Value
95% CI Lower limit Upper limit
Abortion History
Overall
Yes 46.15 (12/26) (28.20-65.92) 33.380 8.38 3.55 19.56 0.000
No 9.22 (40/434) (6.71-12.26)
Cattle
Yes 47.06 (8/17) (25.29-71.79) 20.290 8.17 2.75 24.04 0.000
No 9.68 (21/217) (6.29-14.37)
Buffalo
Yes 40.00 (4/10) (15.00-71.71) 10.180 6.87 1.57 27.08 0.001
No 8.80 (19/216) (5.51-13.28)
Repeat Breeding History Overall
Yes 26.67 (12/45) (14.84-41.10) 11.741 3.42 1.58 7.03 0.001
No 9.64 (40/415) (7.01-12.81)
Cattle
Yes 28.00 (7/25) (12.76-47.94) 6.279 3.31 1.16 8.66 0.012
No 10.53 (22/209) (6.74-15.40)
Buffalo
Yes 25.00 (5/20) (10.41-47.40) 5.274 3.51 1.02 10.44 0.022
No 8.74 (18/206) (5.40-13.43)
History of retention of fetal membranes Overall
Yes 38.88 (14/36) (24.16-55.70) 29.640 6.44 2.98 13.60 0.000
No 8.96 (38/424) (6.51-12.06)
Cattle
Yes 42.85 (6/14) (20.00-68.84) 12.728 6.37 1.90 20.35 0.000
No 10.45 (23/220) (6.87-15.09)
Buffalo
Yes 36.36 (8/22) (18.70-58.24) 18.283 7.12 2.47 19.80 0.000
No 7.35 (15/204) (4.19-11.84)
of diagnosis might be the possible reasons for the varied prevalence rates in different regions of the world. The herd-level prevalence of bovine brucellosis in Multan district was with highest prevalence rate in herds of Tehsil Multan followed by Shujabad and Jalalpur Pirwala. The herds having at least one positive animal for
Brucella antibodies were considered positive [44]. Previously, no herd level prevalence had been reported in the study area. However, Ali et al. [45]. and Khan et al. [46]. reported and herd-based prevalence rates of bovine brucellosis in the Potohar Plateau and Gujranwala districts of Pakistan, respectively. The difference might
Table 7 Association of educational status and awareness level of farmers with prevalence of brucellosis
Groups Total samples (n) Positive samples (n) Negative samples (n) % Prevalence (95% CI) P-value OR OR(95% CI)
Lower Upper
Educational status of Farmers
Matric 350 50 300 14.28 (10.90-18.45) 0.001 11.52 4.37 1.86 12.98
Above Matric 140 5 135 3.57 (1.41-7.96)
Awareness about Brucellosis
Yes 120 6 114 5.00 (2.20-10.52) 0.013 6.179 0.35 0.13 0.79
No 370 49 321 13.24 (10.03-17.09)
be attributed to the fact that availability of favorable climate to the bacteria which can sustain better in humid climatic conditions as compared to dry climate [47, 48]. The variation might also be correlated with differences in husbandry practices, diagnostic technique employed and density/size of herd in different regions. Our results showed a non-significant difference in tehsil wise prevalence of bovine brucellosis however higher relatively lower prevalence rates have been reported in Bannu [49] and prevalence of in cattle and in buffalo has been reported in Rawalpindi and Islamabad [50]. The varied prevalence rates in different parts of the world might be attributed to differences in geo-climatic conditions.
It is well-established that sexually mature animals remain at high risk to be infected with brucellosis [45]. This might be due to increased susceptibility under the influence of sex hormones and elevated levels of erythritol and fetal fluids in the placenta resulting in stimulated growth and replication of bacteria in the reproductive organs [51, 52]. However, young ones may also get infected while feeding on contaminated milk from infected dams. In our study, analysis revealed that the association of different age groups with prevalence of brucellosis in large ruminants was non-significant. Our findings are in agreement with those of Sima et al. [51] and Jamil et al. [26] but contrary to some other previous studies [27, 46, 53, 54]. The variation in findings of different studies might also be due to non-uniformity in categorization of animals in different age groups. In this study, the association of live body weight with prevalence of bovine brucellosis was also determined to be non-significant. No such correlation has been reported previously. The lower body weights might be linked with malnourished status and thus poor immunity of animals which might be one the possible reasons behind higher prevalence rate in animals of lesser body weight groups [55]. On the other hand, brucellosis had also been reported as a cause of reduced weight gain in affected animals [23]. A non-significant association of gender with prevalence of brucellosis was observed in bovine population of study
area. In agreement to our findings, Sima et al. [51] and Khan et al. [46] also reported a non-significant difference in gender-wise prevalence of brucellosis in large ruminants. Conversely, a significant association had also been reported between animal sex and brucellosis with predominantly higher prevalence rates in females [53, 56]. In study area, farmers retain only female calves for milk production and to get next progeny whereas males are being sold out/slaughtered at early age, so we could collect relatively smaller number of sera samples from males as compared to females. Accordingly, a non-significant association in our study might be due to relatively smaller sample size of male animals. In our study, a significant association ( ) was recorded between prevalence of brucellosis and breeds of large ruminants. It was observed that native cattle (Sahiwal) and buffalo (NiliRavi) breeds showed lowest prevalence of brucellosis. On the other hand, non-descriptive breeds showed highest prevalence rates in both cattle and buffalo populations. Previously, Patel et al. [54], Holt et al. [8] and Sima et al. [51] also reported a positive association of animal breeds with prevalence of brucellosis in bovines. The lower prevalence rates in native breeds might be linked with their better adoptability to local geo-climatic conditions and genetic resistance to endemic diseases including brucellosis. It suggested that careful breeding policies should be devised for effective control of endemic diseases. Our results showed a positive association between prevalence of brucellosis and herd size of large ruminants. The medium sized herds having 11-100 animal bovine heads showed significantly lower prevalence rate as compared to large or small sized herds. Previously, Deka et al. [57] and Aulakh et al. [58] had also reported similar findings. Contrarily, Khan et al. [59] and Ali et al. [45] reported a non-significant association between herd size and prevalence of bovine brucellosis. In our study, higher prevalence in small sized herds might be correlated with poor husbandry practices in addition to lack of awareness of farmers about disease. On the other hand, in large sized herds, it might be due to indiscriminate replacement of herd from unknown sources without opting quarantine
protocols along with inappropriate disease screening, hygiene and management [14, 59]. In this study, no association was found between prevalence of brucellosis and number of parities in large ruminants. Previously, Dinka et al. [60] and Khan et al. [59] also reported similar findings. However, a significant difference has been reported in prevalence of brucellosis in cattle with no, single or multiple parities [53].
A non-significant association of brucellosis with pregnancy status was recorded in this study. Previously, a non-significant association between pregnancy and brucellosis in cattle has been reported [53]. However, Khan et al. [50] reported pregnancy status as a potential risk determinant of bovine brucellosis in dairy cattle raised under peri-urban production system in different regions of Punjab-Pakistan. The difference in our study might be due to differences in breed, husbandry practices and geoclimatic conditions of study area. Our results aslo showed a non-significant association of puberty status of female ruminants with brucellosis. It can be hypothesized that young animals are more resistant to Brucella infection, predominantly due to passive immunity. It might also be due to latent infection in calves which could not result in sero-conversion or clinical symptoms till they reach age of puberty or sexual maturity. However, the exact phenomenon is complicated and still to be explored [61].
The insemination protocols always remained a matter of great concern with respect to sexually transmitted diseases. In our study area, majority of the farmers were practicing natural breeding to inseminate their female animals and results revealed significantly higher prevalence of brucellosis in females of large ruminants inseminated through natural breeding however specifically in case of buffaloes, the difference was non-significant ( ). Earlier, Deka et al. [57] also reported significantly lower prevalence in dairy animals for which artificial insemination protocol was adopted for breeding purpose. On the other hand, a non-significant association of insemination method with brucellosis in buffalo population has also been reported by Batistia et al. [62] and this is in accordance with our findings in buffalo population. In a previous study on Columbian herds, it has been reported that farms on natural breeding with bulls from non-certified herds showed significantly higher prevalence of bovine brucellosis as compared to those using artificial insemination [63]. In middle-low socioeconomic settings, animals are mostly bred through natural breeding and there are no standard operating procedures to evaluate and certify their Brucella-free status. Similarly, semen collected at semen production units or affiliated farms is also not passed through stringent quality control checks. It arises the need to introduce the concept of routine screening of breeding bulls for sexually transmitted diseases followed by their certification.
Additionally, strict quality control/assurance protocols should also be devised for semen used for artificial insemination to avoid transmission of STDs through AI.
In female population, association of brucellosis with reproductive disorders including history of abortion, repeat breeding and retained fetal membranes was also determined. Results revealed a significant association of brucellosis with all these reproductive disorders ( ) in both cattle and buffalo populations. Like our findings, various previous studies had also reported a significant association of reproductive disorders with prevalence of brucellosis in bovines [27, 46, 53]. Contrarily, Patel et al. [54]. reported a non-significant correlation of repeat breeding and Khan et al. [48]. reported a non-significant correlation of retained fetal membranes with brucellosis in bovines. As these reproductive problems are cardinal signs of brucellosis, and therefore these results are not surprising. However, in our study area, high prevalence might be correlated with behavior of farmers for not culling the infected animals, introduction of new animals in existing stock without screening and quarantine, higher inclination towards natural breeding and lack of awareness about disease. Due to the reason, there is an increasing threat for transmission of infection in healthy populations through contaminated environment by the excretion of Brucella pathogen with the aborted fetuses, reproductive fluids and retained fetal membranes of infected animals. This is also an alarming situation anticipating the zoonotic implications of brucellosis as an occupational health hazard for personals dealing with animals. The educational status and their level of awareness about bovine brucellosis were found significantly associated with prevalence of brucellosis in large ruminants. The animals raised by farmers with poor educational status and lack of awareness about disease had significantly higher ( ) prevalence rates of brucellosis. Similarly, Arif et al. [64]. also reported significantly lower prevalence of brucellosis in cattle and buffalo farms with owners having university/technical education as compared to those having primary/secondary education. It was also reported that farmers with poor educational staus had no/limited knowledge about brucellosis as compared to educated ones. It might be speculated as a possible reason behind higher prevalence of brucellosis in animals of farmers who had no awareness about brucellosis. Accordingly, farmers with poor educational status are more likely to get infected with brucellosis as an occupational hazard. Al-Shamahy et al. [17]. also reported that humans diagnosed for brucellosis in Yemen had lower level of education as compared to control. It warrants the need to run awareness campaigns about awareness of brucellosis to avoid its animal to animal and zoonotic transmission.
Limitation of our study included the lack of a welldefined data frame pertaining to the number of livestock holdings and rearing of cattle/buffaloes in a scattered manner in both organized and smallholdings with a considerable unregistered population in the study area which might have resulted in selection bias. To mitigate this limitation, we collaborated with the Livestock and Dairy Development Department of the Government of Punjab to include animals from both organized farms and small holdings throughout the study area.

Conclusions and recommendations

In conclusion, bovine brucellosis is endemic in large ruminants of district Multan of southern Punjab, Pakistan. Considering the comparable preliminary screening efficiencies, the locally manufactured RBPT antigen is advantageous to imported RBPT reagents for being cheaper and thus more economical screening tool. Molecular analysis revealed endemicity of both B. abortus and B. melitensis in the study area. The herd size, breed, reproductive disorders, mode of insemination, educational status of farmers and lack of awareness of farmers about the disease had significant association with bovine brucellosis in the study area. It is recommended to devise and implement effective brucellosis control strategies comprising (i) active disease surveillance, (ii) awareness campaigns through print and electronic media, (iii) quality assurance of semen to be used for artificial insemination, (iv) capacity building of diagnostic labs for accurate and timely diagnosis of brucellosis and (v) routine vaccination against Brucella in endemic regions. Further, the current situation also warrants the need to strengthen interdisciplinary coordination among livestock and human health professionals in one health perspectives to ensure and strengthen the human and animal health care systems in the society.

Methods

Study area and target population

This study was conducted from October 2020 to September 2021 in large ruminants (cow and buffalo) located in peri-urban and rural areas of Multan district of Pakistan, located at the bank of river Chenab (Fig. 1). It lies between and at an elevation of 215 m ( 740 ft.) above sea-level. It is one of the biggest districts of the southern Punjab, Pakistan with an area of . The study area has extreme climatic conditions. In summer, its temperature rises to (maximum) and in winter it lowers down up to (minimum). The average precipitation is 127 mm . (http://www.mda.gop.pk/aboutmultan_menu.php; assessed on July 19, 2020).

Study Design and Sample size

Stratified sampling technique was used to collect the samples from the study area. The target population was divided into two strata viz. cattle and buffaloes and sample size from each stratum was calculated by using the formula [65] as follows:
Where, No. of samples; (95% level of confidence); level of precision (5%) and Expected prevalence (fixed at 20%)
By using the above formula, sample size of each stratum was calculated as 245 . Accordingly, a total of 490 blood samples were collected from both cattle and buffalo population of study area.

Blood sampling

For blood sampling, livestock framers located in periurban and rural areas of district Multan were approached with the help of Livestock and Dairy Development Department, Multan Division, Government of the Punjab. After proper restraining, blood sample ( 5 mL ) was aseptically collected from jugular vein of each animal. Out of total, 3 mL blood was shifted to pre-labelled gel & clot activator tubes (BIO-VAC, India) to separate the sera samples and 2 mL was added in Ethylene diamine tetra-acetic acid (EDTA) coated tubes (Xinle Medical, China) to extract the DNA from seropositive animals. All the samples were transferred to One Health Research Lab., Department of Pathobiology, Faculty of Veterinary Sciences, Bahauddin Zakariya University, Multan-Pakistan where sera ware separated in pre-labelled serum vacutainers and stored at and blood samples were stored at till further use.

Descriptive epidemiological data collection

The descriptive epidemiological data regarding the predisposing factors including (age, breed, gender, body weight, abortion history, repeat breeding, retained fetal membranes, physiological status, educational status of livestock farmers, herd size, puberty, mode of insemination etc.) were collected using a well-designed questionnaire.

Screening of brucellosis using Rose Bengal plate test (RBPT)

All the collected sera samples were subjected to preliminary screening by RBPT using three different commercially available RBPT reagents viz. i). RBPT antigen, Veterinary Research Institute (VRI), Lahore, Pakistan, ii). Rose Bengal (Rapid slide agglutination antigen), (ID.vet , France; Cat. # RSA-RB) and iii). Pourquier Rose Bengal
Fig. 1 The map of study area showing different Tehsils of district Multan-Pakistan. The study map was developed using QGIS software (version 3.24.2)
Ag (IDEXX, USA; Cat. # P00215). All the tests were performed according to the instructions of respective manufacturers of RBPT reagents. Briefly, for each RBPT reagent, the Brucella antigen ( ) was mixed with an equal volume of serum followed by shaking for . The sera which showed formation of clear agglutination zone (approx. 2 cm diameter) were considered positive and those with no agglutination were considered negative. The known positive and negative controls were also used with each testing session/batch as a reference.

Serological detection of brucellosis by using Indirect multispecies ELISA Kit

All the collected samples were analyzed using commercially available ELISA kit (ID-Screen Brucellosis Serum Indirect Multispecies; product ref # BRUS-MS-10P; ID. Vet , France) to determine the seroprevalence of brucellosis in target population. The ELISA kit has 100% sensitivity and specificity as reported by the manufacturer. The test was performed as per the manufacturer’s instructions. The plates were examined using ELISA plate reader (ELx800, BioTek, USA) at 450 nm and data was interpreted using ID. Soft Ver 5.11.6 data analysis software (ID. Vet, France).

Molecular detection of Brucella species by polymerase chain reaction (PCR)

The genomic DNA was extracted from seropositive samples by using commercially available GeneJET-Genomic DNA-Purification Kit (ThermoFisher scientific; Catalog # K0721) as per instructions of manufacturer. All the ELISA positive samples were subjected to extraction and
amplification of bacterial genome for the detection of Brucella (B.) species viz. B. abortus and B. melitensis by using genus and species-specific primers. Specific primers for Brucella Genus with forward primer (5′ to 3′) G CTCGGTTGCCAATATCAATGC and reverse primer (3′ to 5′) GGGTAAAGCGTCGCCAGAAG with product size of 151 bp ; for B. abortus forward primer GCGGCT TTTCTATCACGGTATTC and reverse primer CATGC GCTATGATCTGGTTACG with product size of 136 bp and for B. melitensis forward primer AACAAGCGGCA CCCCTAAAA and reverse primer CATGCGCTATGA TCTGGTTACG with product size of 279 pb were used for amplification [66]. The bands of amplicons as seen by UV-transilluminator (Fig. 2a-c). For PCR reaction, a total of reaction mixture containing DreamTaq PCRMaster Mix ( ) (Thermo Scientific, Lithuania), 2 of ( 10 pM ) of each primer, of extracted DNA and of DNase free de-ionized water was prepared. The negative control was a reaction mixture without DNA. Amplification and real-time fluorescence detection was done using a Thermal cycler (MultiGene Optimax, Labnet International, USA). The reaction conditions were as follows: initial denaturation for 10 min at , followed by 35 cycles of for (for Brucella specie) and (for B. Abortus and B. melitensis) for 30 s , and for 1 min and final extension/elongation for 5 min at . The amplified PCR product was subjected to gel electrophoresis using 1.8% agarose gel containing ethidium bromide as a staining reagent followed by visualization of required bands using UV Trans-illuminator (MS Major Science, USA).
Fig. 2 a-c Gel Image showing a) bands of Brucella genus (151 bp), b) B. abortus (136) and c) B. melitensis (279) in PCR product by agarose gel electrophoresis

Statistical analysis

Data collected from the questionnaires and laboratory analyses were entered into Microsoft excel spreadsheet (Microsoft Office 365) and association of brucellosis positivity was assessed with independent variables including species, location, age, gender, herd size, breed, parity, pregnancy and puberty status, mode of insemination, farming system, educational status of farmer, farmers’ awareness regarding brucellosis, history of abortion, retention of fetal membranes, and repeat breeding. These associations were analyzed statistically by employing different tests viz. Pearson Chi-square, Odds Ratio and Confidence intervals (95%) using Minitab (v.19) and R (version 4.2.0) with R Studio (version 2022.02.3+492) as interface. The differences between variables were considered significant at .

Acknowledgements

The authors highly acknowledge the Livestock and Dairy Development Department (Multan Division) for their support in reaching the livestock farmers for collection of blood samples and descriptive epidemiological data.

Author contributions

MMA, MA and MIA conceptualized the idea, designed study and won the research grant to conduct this research work. MMA, GK, MIA, MAA and MSB performed field survey for the collection of samples and descriptive epidemiological data. MMA, GK, ASAKS and AR performed the lab analysis. GK, MMA, ASAKS and AR and ZF helped in study design and performed statistical analysis. MMA, MA and GK prepared the draft of the manuscript. MMA, GK and ASAKS revised the manuscript as suggested by the reviewers. All the authors read and approved the final version.

Funding

This work was financially supported by the Agricultural Linkages Program, Pakistan Agricultural Research Council, Govt. of Pakistan, Islamabad vide grant No. AS 173. (F. No. 3-141/2019 (ALP)-P&DD-PARC dated 09-10-2020).

Data availability

The data that support the findings of this study is available on reasonable request from the corresponding author.

Declarations

The study was approved from the institutional Ethics committee (FVS/AWEC004/2020) and Board of Studies of Department of Pathobiology, Faculty of Veterinary Sciences (FVS) followed by Advanced Studies and Research Board of Bahauddin Zakariya University (BZU), Multan-Pakistan (vide No. Acad/M. Phil/FVS/1535) for ethical issues. Prior written informed consent was obtained from livestock farmers for using the data generated from the analysis of blood/sera samples of their animals for academic, research and publication purposes without showing their identities.
All the methods were performed in accordance with the institutional guidelines regarding humane handling and sampling from animals.
Not applicable.

Competing interests

The authors declare no competing interests.

Author details

¹One Health Research Laboratory, Department of Pathobiology, Faculty of Veterinary Sciences, Bahauddin Zakariya University, Multan, Pakistan Animal Sciences Division, Pakistan Agricultural Research Council, Islamabad, Pakistan
Department of Clinical Sciences, Faculty of Veterinary Sciences, Bahauddin Zakariya University, Multan, Pakistan
Livestock and Dairy Development Department, Directorate of Multan Division, Multan, Pakistan
Received: 13 September 2023 / Accepted: 15 January 2024
Published online: 31 January 2024

References

  1. Ullah Q, Jamil T, Melzer F, Saqib M, Hussain MH, Aslam MA et al. Epidemiology and Associated Risk factors for brucellosis in small ruminants kept at Institutional Livestock Farms in Punjab, Pakistan. Front Veterinary Sci. 2020;7(526).
  2. Dahourou LD, Ouoba LB, Minoungou L-BG, Tapsoba ARS, Savadogo M, Yougbaré B , et al. Prevalence and factors associated with brucellosis and tuberculosis in cattle from extensive husbandry systems in Sahel and HautsBassins regions, Burkina Faso. Sci Afr. 2023;19:e01570.
  3. González-Espinoza G, Arce-Gorvel V, Mémet S, Gorvel J-P. Brucella: reservoirs and niches in animals and humans. Pathogens. 2021;10(2):186.
  4. Corbel MJ. Brucellosis: epidemiology and prevalence worldwide. Brucellosis: clinical and laboratory aspects. CRC Press; 2020. pp. 25-40.
  5. Dean AS, Crump L, Greter H, Hattendorf J, Schelling E, Zinsstag J. Clinical manifestations of human brucellosis: a systematic review and meta-analysis. PLoS Negl Trop Dis. 2012;6(12):e1929.
  6. Ibrahim M, Schelling E, Zinsstag J, Hattendorf J, Andargie E, Tschopp R. Sero-prevalence of brucellosis, Q-fever and Rift Valley fever in humans and livestock in Somali Region, Ethiopia. PLoS Negl Trop Dis. 2021;15(1):e0008100.
  7. Edao BM, Ameni G, Assefa Z, Berg S, Whatmore AM, Wood JL. Brucellosis in ruminants and pastoralists in Borena, Southern Ethiopia. PLoS Negl Trop Dis. 2020;14(7):e0008461.
  8. Holt HR, Bedi JS, Kaur P, Mangtani P, Sharma NS, Gill JPS, et al. Epidemiology of brucellosis in cattle and dairy farmers of rural Ludhiana, Punjab. PLoS Negl Trop Dis. 2021;15(3):e0009102.
  9. Jamil T, Kasi KK, Melzer F, Saqib M, Ullah Q, Khan MR, et al. Revisiting brucellosis in small ruminants of western Border areas in Pakistan. Pathogens. 2020;9(11):929.
  10. Nejad RB, Krecek RC, Khalaf OH, Hailat N, Arenas Gamboa AM. Brucellosis in the Middle East: current situation and a pathway forward. PLoS Negl Trop Dis. 2020;14(5):e0008071.
  11. Dadar M, Tiwari R, Sharun K, Dhama K. Importance of brucellosis control programs of livestock on the improvement of one health. Vet Q. 2021;41(1):137-51.
  12. Zeng J, Duoji C, Yuan Z, Yuzhen S, Fan W, Tian L, et al. Seroprevalence and risk factors for bovine brucellosis in domestic yaks (Bos grunniens) in Tibet, China. Trop Anim Health Prod. 2017;49(7):1339-44.
  13. Joseph OA, Oluwatoyin AV, Comfort AM, Judy S, Babalola CSI. Risk factors associated with brucellosis among slaughtered cattle: epidemiological insight from two metropolitan abattoirs in Southwestern Nigeria. Asian Pac J Trop Dis. 2015;5(9):747-53.
  14. Makita K, Fèvre EM, Waiswa C, Eisler MC, Thrusfield M, Welburn SC. Herd prevalence of bovine brucellosis and analysis of risk factors in cattle in urban and peri-urban areas of the Kampala economic zone, Uganda. BMC Vet Res. 2011;7:60.
  15. Aune K, Rhyan J, Russell R, Roffe T, Corso B. Environmental persistence of Brucella abortus in the Greater Yellowstone Area. J Wildl Manag. 2012;76:253-61.
  16. Hegazy YM, Moawad A, Osman S, Ridler A, Guitian J. Ruminant brucellosis in the Kafr El Sheikh Governorate of the Nile Delta, Egypt: prevalence of a neglected zoonosis. PLoS Negl Trop Dis. 2011;5(1):e944.
  17. AI-Shamahy H, Whitty C, Wright S. Risk factors for human brucellosis in Yemen: a case control study. Epidemiol Infect. 2000;125(2):309-13.
  18. Briones G, Iñón de lannino N, Roset M, Vigliocco A, Paulo PS, Ugalde RA. Brucella abortus cyclic beta-1,2-glucan mutants have reduced virulence in mice and are defective in intracellular replication in HeLa cells. Infect Immun. 2001;69(7):4528-35.
  19. Memish ZA, Balkhy HH. Brucellosis and international travel. J Travel Med. 2004;11(1):49-55.
  20. Seleem MN, Boyle SM, Sriranganathan N. Brucellosis: a re-emerging zoonosis. Vet Microbiol. 2010;140(3-4):392-8.
  21. Zhang N, Huang D, Wu W, Liu J, Liang F, Zhou B, et al. Animal brucellosis control or eradication programs worldwide: a systematic review of experiences and lessons learned. Prev Vet Med. 2018;160:105-15.
  22. Iqbal M, Fatmi Z, Khan MA. Brucellosis in Pakistan: a neglected zoonotic disease. JPMA The Journal of the Pakistan Medical Association. 2020;70(9):1625-6.
  23. Franc KA, Krecek RC, Häsler BN, Arenas-Gamboa AM. Brucellosis remains a neglected disease in the developing world: a call for interdisciplinary action. BMC Public Health. 2018;18(1):125.
  24. Cadmus S, Adesokan H, Stack J. The use of the milk ring test and rose bengal test in brucellosis control and eradication in Nigeria. J S Afr Vet Assoc. 2008;79(3):113-5.
  25. Roushan MR, Amiri MJ, Laly A, Mostafazadeh A, Bijani A. Follow-up standard agglutination and 2-mercaptoethanol tests in 175 clinically cured cases of human brucellosis. Int J Infect Diseases: IJID: Official Publication Int Soc Infect Dis. 2010;14(3):e250-3.
  26. Jamil T, Melzer F, Saqib M, Shahzad A, Khan Kasi K, Hammad Hussain M, et al. Serological and Molecular Detection of Bovine Brucellosis at Institutional Livestock Farms in Punjab, Pakistan. Int J Environ Res Public Health. 2020;17(4):1412.
  27. Khan AU, Melzer F, Hendam A, Sayour AE, Khan I, Elschner MC et al. Seroprevalence and Molecular Identification of Brucella spp. in bovines in Pakistan-investigating Association with risk factors using machine learning. Front Vet Sci. 2020;7.
  28. Baig S. Seroprevalence of bovine brucellosis and analysis of risk factors in cattle and livestock Handler’s in Gilgit – Pakistan, 2019. Int J Infect Dis. 2020;101:534.
  29. Villanueva MA, Mingala CN, Tubalinal GAS, Gaban PBV, Nakajima C, Suzuki Y. Emerging infectious diseases in water buffalo: An economic and public health concern. Emerging Infectious Diseases in Water Buffalo-An Economic and Public Health Concern. 2018.
  30. Pudake R, Jain U, Kole C, Shakya S, Saxena K. Nano-Biosensing Devices Detecting Biomarkers of Communicable and Non-communicable Diseases of Animals. Biosensors in Agriculture: Recent Trends and Future Perspectives. 2020:415-34.
  31. Deresa B, Tulu D, Deressa FB. Epidemiological Investigation of Cattle Abortion and Its Association with brucellosis in Jimma Zone, Ethiopia. Veterinary Medicine: Research and Reports. 2020;11:87-98.
  32. Ukwueze KO, Ishola OO, Dairo MD, Awosanya EJ, Cadmus SI. Seroprevalence of brucellosis and associated factors among livestock slaughtered in OkoOba abattoir, Lagos State, southwestern Nigeria. Pan Afr Med J. 2020;36(1):53.
  33. Ntivuguruzwa JB, Kolo FB, Gashururu RS, Umurerwa L, Byaruhanga C, van Heerden H. Seroprevalence and Associated Risk factors of bovine brucellosis at the Wildlife-Livestock-Human interface in Rwanda. Microorganisms. 2020;8(10):1553.
  34. Fero E, Juma A, Koni A, Boci J, Kirandjiski T, Connor R, et al. The seroprevalence of brucellosis and molecular characterization of Brucella species circulating in the beef cattle herds in Albania. PLoS ONE. 2020;15(3):e0229741.
  35. Shrimali M, Patel S, Chauhan H, Chandel B, Patel A, Sharma K, et al. Seroprevalence of brucellosis in bovine. Int J Curr Microbiol App Sci. 2019;8(11):1730-7.
  36. Madut NA, Muwonge A, Nasinyama GW, Muma JB, Godfroid J, Jubara AS, et al. The sero-prevalence of brucellosis in cattle and their herders in Bahr El Ghazal region, South Sudan. PLoS Negl Trop Dis. 2018;12(6):e0006456.
  37. Pathak AD, Dubal ZB, Karunakaran M, Doijad SP, Raorane AV, Dhuri RB et al. Apparent seroprevalence, isolation and identification of risk factors for brucellosis among dairy cattle in Goa, India. Comparative immunology, microbiology and infectious diseases. 2016;47:1-6.
  38. Asgedom H, Damena D, Duguma R. Seroprevalence of bovine brucellosis and associated risk factors in and around Alage district. Ethiopia SpringerPlus. 2016;5(1):1-8.
  39. Awah-Ndukum J, Mouiche MMM, Kouonmo-Ngnoyum L, Bayang HN, Manchang TK, Poueme RSN, et al. Seroprevalence and risk factors of brucellosis among slaughtered indigenous cattle, abattoir personnel and pregnant women in Ngaoundéré, Cameroon. BMC Infect Dis. 2018;18(1):611.
  40. Chaka H, Aboset G, Garoma A, Gumi B, Thys E. Cross-sectional survey of brucellosis and associated risk factors in the livestock-wildlife interface area of Nechisar National Park, Ethiopia. Trop Anim Health Prod. 2018;50(5):1041-9.
  41. Bifo H, Gugsa G, Kifleyohannes T, Abebe E, Ahmed M. Sero-prevalence and associated risk factors of bovine brucellosis in Sendafa, Oromia Special Zone surrounding Addis Ababa, Ethiopia. PLoS ONE. 2020;15(11):e0238212.
  42. Kamga RMN, Silatsa BA, Farikou O, Kuiate JR, Simo G. Detection of Brucella antibodies in domestic animals of southern Cameroon: implications for the control of brucellosis. Vet Med Sci. 2020;6(3):410-20.
  43. Yanti Y, Sumiarto B, Kusumastuti T, Panus A, Sodirun S, editors. Seroprevalence and risk factors of brucellosis and the brucellosis model at the individual level of dairy cattle in the West Bandung District, Indonesia, Veterinary World, 14 (1): 1-102021: Abstract.
  44. Boukary AR, Saegerman C, Abatih E, Fretin D, Alambédji Bada R, De Deken R, et al. Seroprevalence and potential risk factors for Brucella Spp. Infection in traditional cattle, Sheep and Goats Reared in Urban, Periurban and Rural areas of Niger. PLoS ONE. 2013;8(12):e83175.
  45. Ali S, Akhter S, Neubauer H, Melzer F, Khan I, Abatih EN, et al. Seroprevalence and risk factors associated with bovine brucellosis in the Potohar Plateau, Pakistan. BMC Res Notes. 2017;10(1):73.
  46. Khan MR, Rehman A, Khalid S, Ahmad MUD, Avais M, Sarwar M, et al. Seroprevalence and Associated Risk factors of bovine brucellosis in District Gujranwala, Punjab, Pakistan. Animals. 2021;11(6):1744.
  47. Rodriguez-Morales J. A. Climate change, climate variability and brucellosis. Recent patents on anti-infective drug discovery. 2013;8(1):4-12.
  48. Khan I, Ali S, Hussain R, Raza A, Younus M, Khan N, et al. Serosurvey and potential risk factors of brucellosis in dairy cattle in peri-urban production system in Punjab, Pakistan. Pak Vet J. 2021;41(3):459-62.
  49. Bakhtullah FP, Shahid M, Basit A, Khan MA, Gul S, Wazir I, et al. Sero-prevalence of brucellosis in cattle in southern area of Khyber Pakhtunkhwa, Pakistan. Res J Vet Pract. 2014;2(4):63-6.
  50. Ahmad T, Khan I, Razzaq S, Akhtar R. Prevalence of bovine brucellosis in Islamabad and rawalpindi districts of Pakistan. Pakistan J Zool. 2017;49(3).
  51. Sima DM, Ifa DA, Merga AL, Tola EH. Seroprevalence of bovine brucellosis and Associated Risk factors in Western Ethiopia. Veterinary Medicine: Research and Reports. 2021;12:317.
  52. Haileselassie M, Kalayou S, Kyule M, Asfaha M, Belihu K. Effect of Brucella infection on reproduction conditions of female breeding cattle and its public health significance in Western Tigray, northern Ethiopia. Veterinary medicine international. 2011;2011.
  53. Saeed U, Ali S, LatifT, Rizwan M, Iftikhar A, Ghulam Mohayud Din Hashmi S, et al. Prevalence and spatial distribution of animal brucellosis in central Punjab, Pakistan. Int J Environ Res Public Health. 2020;17(18):6903.
  54. Patel M, Patel P, Prajapati M, Kanani A, Tyagi K, Fulsoundar A. Prevalence and risk factor’s analysis of bovine brucellosis in peri-urban areas under intensive system of production in Gujarat, India. Vet World. 2014;7(7):509-16.
  55. França T, Ishikawa L, Zorzella-Pezavento S, Chiuso-Minicucci F, da Cunha MdLRdS, Sartori A. Impact of malnutrition on immunity and infection. J Venom Anim Toxins Including Trop Dis. 2009;15(3):374-90.
  56. Rahman M, Faruk M, Her M, Kim J, Kang S, Jung S. Prevalence of brucellosis in ruminants in Bangladesh. Vet Med. 2011;56(8):379-85.
  57. Deka RP, Shome R, Dohoo I, Magnusson U, Randolph DG, Lindahl JF. Seroprevalence and risk factors of Brucella infection in dairy animals in urban and rural areas of Bihar and Assam, India. Microorganisms. 2021;9(4):783.
  58. Aulakh H, Patil P, Sharma S, Kumar H, Mahajan V, Sandhu K. A study on the epidemiology of bovine brucellosis in Punjab (India) using milk-ELISA. Acta Vet Brno. 2008;77(3):393-9.
  59. Khan AU, Sayour AE, Melzer F, El-Soally SAGE, Elschner MC, Shell WS, et al. Seroprevalence and molecular identification of Brucella spp. in camels in Egypt. Microorganisms. 2020;8(7):1035.
  60. Dinka H, Chala R. Seroprevalence study of bovine brucellosis in pastoral and agro-pastoral areas of East Showa Zone, Oromia Regional State, Ethiopia. American-Eurasian J Agricultural Environ Sci. 2009;6(5):508-12.
  61. Garry F. Chapter 15 – Miscellaneous Infectious Diseases. In: Divers TJ, Peek SF, editors. Rebhun’s Diseases of Dairy Cattle (Second Edition). Saint Louis: W.B. Saunders; 2008. p. 606-39.
  62. Batista HR, Passos CTS, Nunes Neto OG, Sarturi C, Coelho APL, Moreira TR, et al. Factors associated with the prevalence of antibodies against Brucella abortus in water buffaloes from Santarém, Lower Amazon region, Brazil. Transbound Emerg Dis. 2020;67(S2):44-8.
  63. Cárdenas L, Peña M, Melo O, Casal J. Risk factors for new bovine brucellosis infections in Colombian herds. BMC Vet Res. 2019;15(1):81.
  64. Arif S, Thomson PC, Hernandez-Jover M, McGill DM, Warriach HM, Hayat K, et al. Bovine brucellosis in Pakistan; an analysis of engagement with risk factors in smallholder farmer settings. Veterinary Med Sci. 2019;5(3):390-401.
  65. Pourhoseingholi MA, Vahedi M, Rahimzadeh M. Sample size calculation in medical studies. Gastroenterol Hepatol Bed Bench. 2013;6(1):14-7.
  66. Probert WS, Schrader KN, Khuong NY, Bystrom SL, Graves MH. Real-time multiplex PCR assay for detection of <i>Brucella spp., <i>B. Abortus, and B. melitensis. J Clin Microbiol. 2004;42(3):1290-3.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
  1. Mian Muhammad Awais and Gohar Khadim contributed equally to this work and share the 1st authorship.
    *Correspondence:
    Mian Muhammad Awais
    drawaisuaf@gmail.com; muhammadawais@bzu.edu.pk
    Full list of author information is available at the end of the article