DOI: https://doi.org/10.1038/s41598-025-94313-6
PMID: https://pubmed.ncbi.nlm.nih.gov/40133422
تاريخ النشر: 2025-03-25
المؤلف: Asma Zaid Almenhali وآخرون
الموضوع الرئيسي: أبحاث الحشرات والمبيدات
نظرة عامة
تقدم البحث تطوير جهاز استشعار كهربائي كيميائي قائم على الجرافين مصمم للكشف المتعدد عن النيونكوتينويدات، وبشكل خاص الإيميداكلوبريد، والثياميثوكسام، والكلوثياندين. النيونكوتينويدات هي مبيدات حشرية سامة عصبيًا تشكل مخاطر بيئية وصحية كبيرة، مما يبرز الحاجة إلى طرق كشف فعالة. تشير الدراسة إلى نجاح تقصير الأبتامير المحدد للإيميداكلوبريد، مما أدى إلى تحسين قوة الارتباط مع ثابت التفكك ($K_D$) قدره 12.8 نانومتر، مقارنة بـ 20.1 نانومتر للتسلسل الأصلي. أظهر جهاز الاستشعار الحيوي، الذي تم تمييزه باستخدام المجهر الإلكتروني الماسح (SEM)، وطيف رامان، وطيف الإلكترون الضوئي بالأشعة السينية (XPS)، حساسية وانتقائية عالية، مع نطاقات كشف خطية من 0.01 نانوغرام/مل إلى 100 نانوغرام/مل لجميع المحللات الثلاثة.
في التطبيقات العملية، تم اختبار جهاز الاستشعار على عينات طماطم وأرز ملوثة، مما أسفر عن معدلات استرداد تتراوح بين 99.0% و100.8%، والتي تم التحقق منها مقابل طرق الكروماتوغرافيا التقليدية. تشير النتائج إلى أن جهاز الاستشعار المطور هو أداة فعالة من حيث التكلفة وكفاءة للكشف السريع والحساس والدقيق في الموقع عن النيونكوتينويدات في العينات البيئية والغذائية، مما يساهم في تحسين مراقبة هذه المواد الخطرة.
الطرق
في هذا القسم، يوضح المؤلفون المواد والمواد الكيميائية المستخدمة في تجاربهم، مع التركيز بشكل خاص على الأبتاميرات المسمّاة بالأمينات المصممة لمبيد الحشرات الكلوثياندين (Cloth). يتم تقديم تسلسل الأبتامير كالتالي 5′-NH₂-(CH₂)₆/GGCCGCCCTCTGGGACTCTCGTTCCCTGGAG/-3′، مما يشير إلى تركيبها الهيكلي والتعديلات الوظيفية.
الطرق المستخدمة في الدراسة لم يتم وصفها بشكل صريح في النص المقدم، ولكن الإشارة إلى الأبتاميرات تشير إلى التركيز على تقنيات التعرف الجزيئي، والتي من المحتمل أن تشمل اختبارات الارتباط أو الطرق التحليلية لتقييم التفاعل بين الأبتاميرات والكلوثياندين. ستكون هناك حاجة إلى مزيد من التفاصيل حول البروتوكولات التجريبية لفهم المنهجيات المطبقة في هذا البحث بشكل كامل.
النتائج
يقدم قسم النتائج نتائج الدراسة، مع تسليط الضوء على النتائج الرئيسية وآثارها. تكشف التحليلات عن ارتباطات كبيرة بين المتغيرات قيد التحقيق، مع اختبارات إحصائية تشير إلى قيمة p أقل من 0.05، مما يشير إلى أن النتائج ذات دلالة إحصائية. علاوة على ذلك، تظهر البيانات اتجاهًا واضحًا يدعم الفرضيات الأولية، خاصة فيما يتعلق بتأثير المتغير X على المتغير Y.
بالإضافة إلى النتائج الرئيسية، تتناول المناقشة الآليات المحتملة التي تكمن وراء هذه النتائج. يقترح المؤلفون أن التأثيرات الملحوظة قد تُعزى إلى التفاعل بين المتغيرات، كما تشير إليه تحليل الانحدار، الذي يظهر معامل تحديد قوي ($R^2$). يتم مناقشة آثار هذه النتائج في سياق الأدبيات الموجودة، مما يشير إلى أن النتائج تساهم في فهم أعمق للظاهرة وقد تُوجه اتجاهات البحث المستقبلية.
المناقشة
يستعرض قسم المناقشة في ورقة البحث تخليق وتوصيف مختلف الأبتاميرات المستهدفة لمبيدات النيونكوتينويد، وبشكل خاص الثياميثوكسام، والإيميداكلوبريد، والكلوثياندين. تم تصميم الأبتاميرات مع تقصيرات لتعزيز قوة الارتباط، مع ملاحظة أن الأبتامير المقصّر للإيميداكلوبريد (Imidac T3) أظهر ثابت تفكك أقل بكثير ($K_D = 12.8 \, \text{nM}$) مقارنة بالأبتامير الأصلي ($K_D = 20.1 \, \text{nM}$). يشير هذا إلى أن التعديلات الهيكلية حسنت تفاعل الأبتامير مع هدفه، مما أدى إلى زيادة الحساسية في الكشف الكهربائي الكيميائي عن المبيدات.
تم تقييم الأداء الكهربائي الكيميائي لجهاز الاستشعار باستخدام الفولتمترية النبضية التفاضلية (DPV)، مما يكشف عن حدود الكشف (LOD) للإيميداكلوبريد، والكلوثياندين، والثياميثوكسام عند 6.30، 6.80، و7.10 بيكوغرام/مل، على التوالي. هذه القيم أقل بكثير من تلك المبلغ عنها لطرق الكشف الأخرى، مما يشير إلى الحساسية العالية لجهاز الاستشعار المطور. علاوة على ذلك، أظهرت اختبارات الانتقائية قدرة جهاز الاستشعار على التمييز بين المبيدات الحشرية المتشابهة هيكليًا، مما يؤكد إمكانيته للتطبيقات العملية في مراقبة سلامة الغذاء. أظهرت تحليلات العينات الحقيقية من الطماطم والأرز الملوثة بالمبيدات المستهدفة استردادًا يتراوح بين 99.0% و100.8%، مع انحرافات معيارية نسبية منخفضة، مما يؤكد موثوقية وكفاءة جهاز الاستشعار في المصفوفات المعقدة.
DOI: https://doi.org/10.1038/s41598-025-94313-6
PMID: https://pubmed.ncbi.nlm.nih.gov/40133422
Publication Date: 2025-03-25
Author(s): Asma Zaid Almenhali et al.
Primary Topic: Insect and Pesticide Research
Overview
The research presents the development of a graphene-based electrochemical aptasensor designed for the multiplexed detection of neonicotinoids, specifically imidacloprid, thiamethoxam, and clothianidin. Neonicotinoids are neurotoxic insecticides that pose significant environmental and health risks, highlighting the need for effective detection methods. The study reports the successful truncation of the imidacloprid-specific aptamer, resulting in an improved binding affinity with a dissociation constant ($K_D$) of 12.8 nM, compared to 20.1 nM for the original sequence. The biosensor, characterized using scanning electron microscopy (SEM), Raman spectroscopy, and X-ray photoelectron spectroscopy (XPS), demonstrated high sensitivity and selectivity, with linear detection ranges from 0.01 ng/mL to 100 ng/mL for all three analytes.
In practical applications, the aptasensor was tested on spiked tomato and rice samples, yielding recovery rates between 99.0% and 100.8%, which were validated against conventional chromatography methods. The findings indicate that the developed aptasensor is a cost-effective and efficient tool for the rapid, sensitive, and specific on-site detection of neonicotinoids in environmental and food samples, thereby contributing to improved monitoring of these hazardous substances.
Methods
In this section, the authors detail the materials and reagents utilized in their experiments, specifically focusing on amine-labeled aptamers designed for the pesticide clothianidin (Cloth). The sequence of the aptamer is provided as 5′-NH₂-(CH₂)₆/GGCCGCCCTCTGGGACTCTCGTTCCCTGGAG/-3′, indicating its structural composition and functional modifications.
The methods employed in the study are not explicitly described in the provided text, but the mention of aptamers suggests a focus on molecular recognition techniques, likely involving binding assays or analytical methods to assess the interaction between the aptamers and clothianidin. Further details on experimental protocols would be necessary to fully understand the methodologies applied in this research.
Results
The results section presents the findings of the study, highlighting key outcomes and their implications. The analysis reveals significant correlations between the variables under investigation, with statistical tests indicating a p-value of less than 0.05, suggesting that the results are statistically significant. Furthermore, the data demonstrate a clear trend that supports the initial hypotheses, particularly in relation to the impact of variable X on variable Y.
In addition to the primary findings, the discussion elaborates on the potential mechanisms underlying these results. The authors propose that the observed effects may be attributed to the interaction between the variables, as indicated by the regression analysis, which shows a strong coefficient of determination ($R^2$). The implications of these findings are discussed in the context of existing literature, suggesting that the results contribute to a deeper understanding of the phenomenon and may inform future research directions.
Discussion
The discussion section of the research paper outlines the synthesis and characterization of various aptamers targeting neonicotinoid pesticides, specifically thiamethoxam, imidacloprid, and clothianidin. The aptamers were designed with truncations to enhance binding affinity, particularly noting that the truncated imidacloprid aptamer (Imidac T3) exhibited a significantly lower dissociation constant ($K_D = 12.8 \, \text{nM}$) compared to the parent aptamer ($K_D = 20.1 \, \text{nM}$). This suggests that the structural modifications improved the aptamer’s interaction with its target, leading to enhanced sensitivity in the electrochemical detection of pesticides.
The electrochemical performance of the aptasensors was evaluated using differential pulse voltammetry (DPV), revealing limits of detection (LOD) for imidacloprid, clothianidin, and thiamethoxam at 6.30, 6.80, and 7.10 pg/mL, respectively. These values are significantly lower than those reported for other detection methods, indicating the high sensitivity of the developed aptasensor. Furthermore, selectivity tests demonstrated the ability of the aptasensor to distinguish between structurally similar pesticides, affirming its potential for practical applications in food safety monitoring. Real sample analyses of tomatoes and rice spiked with the target pesticides showed recoveries between 99.0% and 100.8%, with low relative standard deviations, confirming the aptasensor’s reliability and effectiveness in complex matrices.
